THE PROCESS OF Leishmania INFECTION - DISEASE AND NEW PERSPECTIVES OF PALEOPARASITOLOGY

Species of the genus Leishmania (Kinetoplastida, Trypanosomatidae) are causative agents of leishmaniasis, a complex disease with variable clinical spectrum and epidemiological diversity, constituting, in some countries, a serious public health problem. The origin and evolution of leishmaniasis has been under discussion regarding some clinical and parasitological aspects. After the introduction of paleoparasitology, molecular methods and immunodiagnostic techniques have been applied allowing the recovery of parasite remains, as well as the diagnosis of past infections in humans and other hosts. The dating of archaeological samples has allowed the parasitological analysis in time and space. This manuscript presents the state of the art of leishmaniasis and prospects related to paleoparasitology studies and their contribution to the evolutionary and phylogenetic clarification of parasites belonging to the genus Leishmania, and the leishmaniasis caused by them.

Identification of serological biomarkers of infection, disease progression and treatment efficacy for leprosy

Although leprosy is curable with drug treatment, the identification of biomarkers of infection, disease progression and treatment efficacy would greatly help to reduce the overall prevalence of the disease. Reliable biomarkers would also reduce the incidence of grade-2 disability by ensuring that those who are most at risk are diagnosed and treated early or offered repeated treatments in the case of relapse. In this study, we examined the reactivity of sera from lepromatous and tuberculoid leprosy patients (LPs) against a panel of 12 recombinant Mycobacterium leprae proteins and found that six proteins were strongly recognised by multibacillary (MB) patients, while only three were consistently recognised by paucibacillary patients. To better understand the dynamics of patient antibody responses during and after drug therapy, we measured antibody titres to four recombinant proteins, phenolic glycolipid-I and lipoarabinomannan at baseline and up to two years after diagnosis to investigate the temporal changes in the antibody titres. Reactivity patterns to individual antigens and decreases in antibody titres were patient-specific. Antibody titres to proteins declined more rapidly vs. those to carbohydrate and glycolipid antigens. Compared to baseline values, increases in antibody titres were observed during reactional episodes in one individual. Additionally, antibody responses against a subset of antigens that provided a good prognostic indicator of disease progression were analysed in 51 household contacts of MB index cases for up to two years. Although the majority of these contacts showed no change or exhibited decreases in antibody titres, seven individuals developed higher titres towards one or more of these antigens and one individual with progressively higher titres was diagnosed with borderline lepromatous leprosy 19 months after enrolment. The results of this study indicate that antibody titres to specific M. leprae antigens can be used to monitor treatment efficacy in LPs and assess disease progression in those most at risk for developing this disease.

Asymptomatic primary Epstein-Barr virus infection occurs in the absence of blood T-cell repertoire perturbations despite high levels of systemic viral load

Primary infection with the human herpesvirus, Epstein-Barr virus (EBV), may result in subclinical seroconversion or may appear as infectious mononucleosis (IM), a lymphoproliferative disease of variable severity. Why primary infection manifests differently between patients is unknown, and, given the difficulties in identifying donors undergoing silent seroconversion, little information has been reported. However, a longstanding assumption has been held that IM represents an exaggerated form of the virologic and immunologic events of asymptomatic infection. T-cell receptor (TCR) repertoires of a unique cohort of subclinically infected patients undergoing silent infection were studied, and the results highlight a fundamental difference between the 2 forms of infection. In contrast to the massive T-cell expansions mobilized during the acute symptomatic phase of IM, asymptomatic donors largely maintain homeostatic T-cell control and peripheral blood repertoire diversity. This disparity cannot simply be linked to severity or spread of the infection because high levels of EBV DNA were found in the blood from both types of acute infection. The results suggest that large expansions of T cells within the blood during IM may not always be associated with the control of primary EBV infection and that they may represent an overreaction that exacerbates disease. (C) 2001 by The American Society of Hematology.

Variable viral clearance despite adequate ganciclovir plasma levels during valganciclovir treatment for cytomegalovirus disease in D+/R- transplant recipients.

ABSTRACT: BACKGROUND: Valganciclovir, the oral prodrug of ganciclovir, has been demonstrated equivalent to iv ganciclovir for CMV disease treatment in solid organ transplant recipients. Variability in ganciclovir exposure achieved with valganciclovir could be implicated as a contributing factor for explaining variations in the therapeutic response. This prospective observational study aimed to correlate clinical and cytomegalovirus (CMV) viral load response (DNAemia) with ganciclovir plasma concentrations in patients treated with valganciclovir for CMV infection/disease. METHODS: Seven CMV D+/R- transplant recipients (4 kidney, 2 liver and 1 heart) were treated with valganciclovir (initial dose was 900-1800 mg/day for 3-6.5 weeks, followed by 450-900 mg/day for 2-9 weeks). DNAemia was monitored by real time quantitative PCR and ganciclovir plasma concentration was measured at trough (Ctrough) and 3 h after drug administration (C3h) by HPLC. RESULTS: Four patients presented with CMV syndrome, two had CMV tissue-invasive disease after prophylaxis discontinuation, and one liver recipient was treated pre-emptively for asymptomatic rising CMV viral load 5 weeks post-transplantation in the absence of prophylaxis. CMV DNAemia decreased during the first week of treatment in all recipients except in one patient (median decrease: -1.2 log copies/mL, range: -1.8 to 0) despite satisfactory ganciclovir exposure (AUC0-12 = 48 mg.h/L, range for the 7 patients: 40-118 mg.h/L). Viral clearance was obtained in five patients after a median of time of 34 days (range: 28-82 days). Two patients had recurrent CMV disease despite adequate ganciclovir exposure (65 mg.h/L, range: 44-118 mg.h/L). CONCLUSIONS: Valganciclovir treatment for CMV infection/disease in D+/R- transplant recipients can thus result in variable viral clearance despite adequate ganciclovir plasma concentrations, probably correlating inversely with anti-CMV immune responses after primary infection.

Association between mannose-binding lectin (MBL) deficiency and cytomegalovirus (CMV) infection after kidney transplantation

MBLdeficiency is thought to be a risk factor for the development of viral infection, such as genital herpes and HSV-2 meningitis. However, there is limited data on the possible interaction between MBL and CMV, especially after organ transplantation. Between 2003 and 2005, we measured MBL levels in 16 kidney transplant recipients with high-risk CMV serostatus (donor positive/recipient negative, D+/R−). All patients receivedCMV prophylaxis of valganciclovir 450 mg/day for 3 months after transplantation. After stopping valganciclovir, CMV-DNA was measured in whole blood by real time PCR every 2 weeks for 3 months. CMV infections were diagnosed according to the recommendations of the AST. MBL levels were measured in stored pre-transplantation sera by an investigator blinded to the CMV complications. MBL levels below 500 ng/ml were considered as being functionally deficient. After a follow-up of at least 10 months, seven patients out of 16 developed CMV disease (three CMV syndrome, and four probable invasive disease, i.e. two colitis and two hepatitis), four patients developed asymptomatic CMV infection, and five patients never developed any sign of CMV replication. Peak CMV-DNA was higher in patients with CMV disease than in those with asymptomatic infection (4.64 versus 2.72 mean log copy CMV-DNA/106 leukocytes, p < 0.05). Overall, 9/16 patients (56%) had MBL deficiency: 5/7 (71%) of patients with CMV disease, 4/4 (100%) of patients with asymptomatic CMVinfection, and 0/5 (0%) of patients withoutCMVinfection (p < 0.005, between CMV infection/disease versus no infection or control blood donors). There were no significant differences in age, gender or immunosuppressive regimens between the groups. MBL deficiency may be a significant risk factor for the development of post-prophylaxisCMVinfection in D+/R−kidney recipients, suggesting a new role of innate immunity in the control of CMV infection after organ transplantation.

Association between mannose-binding lectin deficiency and cytornegalovirus infection course after organ transplantation.

Background: Mannose binding lectin (MBL) is an innate humoral immune effector and MBL defi ciency has been suggested as a risk factor for the development of certain viral infections. However, there is no data about the possible association between MBL defi ciency and CMV, especially after organ transplantation. Methods: We measured MBL levels in 16 kidney transplant recipients with highrisk CMV serostatus (D+/R-) who received valganciclovir prophylaxis for 3 months (Study 1). In addition, MBL levels were retrospectively assayed in 55 recipients from a previous study of organ transplant recipients managed preemptively (Study 2). In Study 2, protracted CMV infection was associated with recipient CMV seronegativity, increasing age, and high viral load during the initial episode. In both studies, MBL defi ciency was diagnosed if MBL levels were <500 ng/ml. Results: In Study 1, after a follow-up of 12 months, 7 out of 16 patients developed CMV disease, 4 patients developed asymptomatic CMV infection, and 5 patients never developed any sign of CMV replication. Overall, 9/16 patients (56%) had MBL defi ciency: 5/7 (71%) of patients with CMV disease, 4/4 (100%) of patients with asymptomatic CMV infection, and 0/5 (0%) of patients without CMV infection (p=0.005, between CMV infection/disease versus no infection). Median MBL concentrations were higher in patients without CMV infection than in those with CMV infection (p<0.005). In Study 2, among 30 patients with CMV infection, 9/25 (36%) patients without MBL defi ciency had a protracted course, while 4/5 (80%) with MBL defi ciency did so (p=0.07). Conclusion: Data from two separate patient populations suggest that MBL defi ciency may be a signifi cant risk factor for late CMV disease/infection after prophylaxis, and protracted infection after preemptive treatment. This suggests a role for MBL in the control of CMV infection after organ transplantation.

Surgical infection and malnutrition

Background: Malnutrition in surgical patients is associated with delayed recovery, higher rates of morbidity and mortality, prolonged hospital stay, increased healthcare costs and a higher early re-admission rate. Methods: Data synthesis after review of pertinent literature. Results: The aetiology of malnutrition is multifactorial. In cancer patients, there is an abnormal peripheral glucose disposal, gluconeogenesis, and whole-body glucose turnover. Malnourished cancer patients undergoing major operations are at significant risk from perioperative complications such as infectious complications. Surgical aggression generates an inflammatory response which worsens intermediary metabolism. Conclusions: Nutritional evaluation and nutritional support must be performed in all surgical patients, in order to minimize infectious complications. Enteral nutrition early in the postoperative period is effective and well tolerated reducing infectious complications, improving wound healing and reducing length of hospital stay. Pharmaconutrition is indicated in those patients, who benefit from enteral administration of arginine, omega 3 and RNA, as well as parenteral glutamine supplementation. When proximal sutures are used, tubes allowing early jejunal feeding should be used.

Salinity influences disease-induced mortality of the oyster Crassostrea gigas and infectivity of the ostreid herpesvirus 1 (OsHV-1)

Mortality of young Pacific oysters Crassostrea gigas associated with the ostreid herpesvirus 1 (OsHV-1) is occurring worldwide. Here, we examined for the first time the effect of salinity on OsHV-1 transmission and disease-related mortality of C. gigas, as well as salinity-related effects on the pathogen itself. To obtain donors for OsHV-1 transmission, we transferred laboratory-raised oysters to an estuary during a disease outbreak and then back to the laboratory. Oysters that tested OsHV-1 positive were placed in seawater tanks (35‰, 21°C). Water from these tanks was used to infect naïve oysters in 2 experimental setups: (1) oysters acclimated or non-acclimated to a salinity of 10, 15, 25 and 35‰ and (2) oysters acclimated to a salinity of 25‰; the latter were exposed to OsHV-1 water diluted to a salinity of 10 or 25‰. The survival of oysters exposed to OsHV-1 water and acclimated to a salinity of 10‰ was >95%, compared to only 43 to 73% survival in oysters acclimated to higher salinities (Expt 1), reflecting differences in the levels of OsHV-1 DNA and viral gene expression (Expts 1 and 2). However, the survival of their non-acclimated counterparts was only 23% (Expt 2), and the levels of OsHV-1 DNA and the expression of 4 viral genes were low (Expt 1). Thus, OsHV-1 may not have been the ultimate cause of mortality in non-acclimated oysters weakened by a salinity shock. It appears that reducing disease risk by means of low salinity is unlikely in the field.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Hepatitis B (HBV), Hepatitis C (HCV) and Hepatitis Delta (HDV) Viruses in the Colombian Population-How Is the Epidemiological Situation?

Background: Viral hepatitis B, C and delta still remain a serious problem worldwide. In Colombia, data from 1980s described that HBV and HDV infection are important causes of hepatitis, but little is known about HCV infection. The aim of this study was to determine the currently frequency of HBV, HCV and HDV in four different Colombian regions. Methodology/Principal Findings: This study was conducted in 697 habitants from 4 Colombian departments: Amazonas, Choco, Magdalena and San Andres Islands. Epidemiological data were obtained from an interview applied to each individual aiming to evaluate risk factors related to HBV, HCV or HDV infections. All samples were tested for HBsAg, anti-HBc, anti-HBs and anti-HCV markers. Samples that were positive to HBsAg and/or anti-HBc were tested to anti-HDV. Concerning the geographical origin of the samples, the three HBV markers showed a statistically significant difference: HBsAg (p = 0.033) and anti-HBc (p < 0.001) were more frequent in Amazonas and Magdalena departments. Isolated anti-HBs (a marker of previous vaccination) frequencies were: Choco (53.26%), Amazonas (32.88%), Magdalena (17.0%) and San Andres (15.33%) p < 0.001. Prevalence of anti-HBc increased with age; HBsAg varied from 1.97 to 8.39% (p = 0.033). Amazonas department showed the highest frequency for anti-HCV marker (5.68%), while the lowest frequency was found in San Andres Island (0.66%). Anti-HDV was found in 9 (5.20%) out of 173 anti-HBc and/or HBsAg positive samples, 8 of them from the Amazonas region and 1 from them Magdalena department. Conclusions/Significance: In conclusion, HBV, HCV and HDV infections are detected throughout Colombia in frequency levels that would place some areas as hyperendemic for HBV, especially those found in Amazonas and Magdalena departments. Novel strategies to increase HBV immunization in the rural population and to strengthen HCV surveillance are reinforced by these results.

Polymorphisms in innate immunity genes and patients response to dendritic cell-based HIV immuno-treatment

Dendritic cells (DCs)-based vaccine was demonstrated to increase HIV specific cellular immune response; however, in some HIV-infected patients, the response to the vaccine resulted to be not effective. In order to understand if the outcome of the vaccination may be influenced by the host`s genome and natural immunity, we studied the innate immune genome of HIV-infected patients previously vaccinated with DCs. We identified 15 SNPs potentially associated with the response to the immuno-treatment and two SNPs significantly associated with the modulation of the response to the DC vaccine: MBL2 rs10824792 and NOS1 rs693534. These two SNPs were also studied in different ethnic groups (Brazilians, African and Caucasian) of HIV-infected, exposed uninfected and unexposed uninfected subjects. The HIV positive Caucasian patients were also characterized by different disease progressions. Our findings suggest that, independently and/or in addition to other variables. the host`s genome could significantly contribute to the modulation of the response to the DC vaccine. (C) 2009 Elsevier Ltd. All rights reserved.

Characteristics of HIV patients referred to a medication adherence program in Switzerland.

Background Since August 2004, HIV patients who encounter -or are at risk of -problems with their antiretroviral treatment (ART) are referred by their physician to a medication adherence program at the community pharmacy of the Department of Ambulatory Care and Community Medicine in Lausanne (Switzerland). The program combines motivational interviewing and electronic drug monitoring. Objective To compare the demographic and clinical characteristics as well as ART of HIV patients referred to the adherence program versus those of the entire HIV population followed in the same infection disease department in the same time frame. Method Retrospective descriptive cross-sectional study. Study time frame was defined according to the period with the highest number of HIV patients visiting the adherence program. Results Subjects included in the adherence program had more often a protease inhibitor-based regimen (64 %; 95 % CI [52-75 %] vs. 37 %) and lower CD4 cell counts (419 (252.0, 521.0); 95 % CI [305-472] vs. 500 (351.0, 720.0)) than the entire HIV population. A majority of women were included in the adherence program (66 %; 95 % CI [54-76 %] vs. 39% in the entire HIV population). Conclusion Subjects referred to the adherence program were different from the entire HIV population and showed worse clinical outcomes and were more often under salvage therapy. More women than men were included. Reasons for such a difference need to be further explored.

Oral valganciclovir prophylaxis in kidney transplant recipients

Background: Immunosuppressive and antivira[ prophy[ actic drugs are needed to prevent acute rejection and infection after organ transplantation. We assessed the effectiveness of a new combined regimen introduced at our transplantation center. Methods: We reviewed at[ consecutive patients who underwent kidney transplantation at our institution over a 5.5-year period, with a follow-up of at [east 6 months. Patients transplanted from 1/2000 to 3/2003 (Period 1) were compared to patients transplanted from 4/2003 to 7/2005 (Period 2). In period 1, patients were treated with Basi[iximab, Cic[osporin, steroids and Mycophenotate or Azathioprine. Prophylaxis with Va[acic[ ovir was prescribed in CMV D+/R- patients; otherwise, a preemptive antivira[ approach was used. In period 2, immunosuppressive drugs were Basi[- iximab, Tacro[imus, steroids and Mycopheno[ate. A 3-month CMV prophylaxis with Va[gancic[ovir was used, except in D-/R- patients. Results: Sixty-three patients were transplanted in period 1 and 70 patients in period 2. Baseline characteristics of both groups were comparable; in particular 17% of patients were CMV D+/R- in period 1 compared to 23% in period 2 (p=0.67). Acute rejection was more frequent in period 1 than in period 2 (40% of patients vs 7%, respectively p<0.001). Nineteen patients (30%) in period 1 were diagnosed with CMV infection/disease that required treatment, compared with 8 patients (11.4%) in period 2 (p = 0.003). Of these 8 patients, at[ had CMV infection/disease after discontinuation of Va[gancic[ovir prophylaxis, 6 were D+/R- (75%), and at[ were treated with oral Va[gancic[ovir. There was no difference between periods in terms of incidence of BK nephropathy, post-transplant [ymphopro[ iferative disease, graft toss, and mortality. Conclusions: These results indicate that a 3-month course of oral Va[gancic[ovir is very effective to prevent CMV infection/disease in kidney transplantation. Late-onset CMV disease is a residual problem in D+/R- patients receiving VGC prophylaxis.

The ant fauna of hospitals: advancements in public health and research priorities in Brazil

Ants inhabit several types of natural and urban habitats, where they successfully nest. In urban environments, the hospitals should be considered priority for studies, as ants pose risks to human health due to their pathogen carrying potential. We aimed at surveying the literature about studies on ants in hospital settings in Brazil in the past 20 years. We found 40 papers in 22 journals, the first one published in 1993. Among them, 26 papers assessed pathogenic microorganisms on ants. We recorded 59 ant species, being Tapinoma melanocephalumthe most common. The Minas Gerais and São Paulo states had the largest number of published papers. Mato Grosso do Sul and Rio Grande do Sul showed the highest number of species. Exotic ant species were recorded in all states, except Goiás. Considering the potential to carry microorganisms and the importance of thorough studies on the ecology of ant species, our results can support and guide further research in Brazil.

Global Genomic Diversity of Human Papillomavirus 6 Based on 724 Isolates and 190 Complete Genome Sequences.

Human papillomavirus type 6 (HPV6) is the major etiological agent of anogenital warts and laryngeal papillomas and has been included in both the quadrivalent and nonavalent prophylactic HPV vaccines. This study investigated the global genomic diversity of HPV6, using 724 isolates and 190 complete genomes from six continents, and the association of HPV6 genomic variants with geographical location, anatomical site of infection/disease, and gender. Initially, a 2,800-bp E5a-E5b-L1-LCR fragment was sequenced from 492/530 (92.8%) HPV6-positive samples collected for this study. Among them, 130 exhibited at least one single nucleotide polymorphism (SNP), indel, or amino acid change in the E5a-E5b-L1-LCR fragment and were sequenced in full. A global alignment and maximum likelihood tree of 190 complete HPV6 genomes (130 fully sequenced in this study and 60 obtained from sequence repositories) revealed two variant lineages, A and B, and five B sublineages: B1, B2, B3, B4, and B5. HPV6 (sub)lineage-specific SNPs and a 960-bp representative region for whole-genome-based phylogenetic clustering within the L2 open reading frame were identified. Multivariate logistic regression analysis revealed that lineage B predominated globally. Sublineage B3 was more common in Africa and North and South America, and lineage A was more common in Asia. Sublineages B1 and B3 were associated with anogenital infections, indicating a potential lesion-specific predilection of some HPV6 sublineages. Females had higher odds for infection with sublineage B3 than males. In conclusion, a global HPV6 phylogenetic analysis revealed the existence of two variant lineages and five sublineages, showing some degree of ethnogeographic, gender, and/or disease predilection in their distribution. IMPORTANCE: This study established the largest database of globally circulating HPV6 genomic variants and contributed a total of 130 new, complete HPV6 genome sequences to available sequence repositories. Two HPV6 variant lineages and five sublineages were identified and showed some degree of association with geographical location, anatomical site of infection/disease, and/or gender. We additionally identified several HPV6 lineage- and sublineage-specific SNPs to facilitate the identification of HPV6 variants and determined a representative region within the L2 gene that is suitable for HPV6 whole-genome-based phylogenetic analysis. This study complements and significantly expands the current knowledge of HPV6 genetic diversity and forms a comprehensive basis for future epidemiological, evolutionary, functional, pathogenicity, vaccination, and molecular assay development studies.