981 resultados para Infected
Resumo:
In the Amazon Region, there is a virtual absence of severe malaria and few fatal cases of naturally occurring Plasmodium falciparum infections; this presents an intriguing and underexplored area of research. In addition to the rapid access of infected persons to effective treatment, one cause of this phenomenon might be the recognition of cytoadherent variant proteins on the infected red blood cell (IRBC) surface, including the var gene encoded P. falciparum erythrocyte membrane protein 1. In order to establish a link between cytoadherence, IRBC surface antibody recognition and the presence or absence of malaria symptoms, we phenotype-selected four Amazonian P. falciparum isolates and the laboratory strain 3D7 for their cytoadherence to CD36 and ICAM1 expressed on CHO cells. We then mapped the dominantly expressed var transcripts and tested whether antibodies from symptomatic or asymptomatic infections showed a differential recognition of the IRBC surface. As controls, the 3D7 lineages expressing severe disease-associated phenotypes were used. We showed that there was no profound difference between the frequency and intensity of antibody recognition of the IRBC-exposed P. falciparum proteins in symptomatic vs. asymptomatic infections. The 3D7 lineages, which expressed severe malaria-associated phenotypes, were strongly recognised by most, but not all plasmas, meaning that the recognition of these phenotypes is frequent in asymptomatic carriers, but is not necessarily a prerequisite to staying free of symptoms.
Resumo:
Reports of long-term tenofovir disoproxil fumarate (TDF) treatment in HIV-infected adolescents are limited. We present final results from the open-label (OL) TDF extension following the randomized, placebo (PBO)-controlled, double-blind phase of GS-US-104-0321 (Study 321). HIV-infected 12- to 17-year-olds treated with TDF 300 mg or PBO with an optimized background regimen (OBR) for 24-48 weeks subsequently received OL TDF plus OBR in a single arm study extension. HIV-1 RNA and safety, including bone mineral density (BMD), was assessed in all TDF recipients. Eighty-one subjects received TDF (median duration 96 weeks). No subject died or discontinued OL TDF for safety/tolerability. At week 144, proportions with HIV-1 RNA <50 copies/mL were 30.4% (7 of 23 subjects with baseline HIV-1 RNA >1000 c/mL initially randomized to TDF), 41.7% (5 of 12 subjects with HIV-1 RNA <1000 c/mL who switched PBO to TDF) and 0% (0 of 2 subjects failed randomized PBO plus OBR with HIV-1 RNA >1000 c/mL and switched PBO to TDF). Viral resistance to TDF occurred in 1 subject. At week 144, median decrease in estimated glomerular filtration rate was 38.1 mL/min/1.73 m (n = 25). Increases in median spine (+12.70%, n = 26) and total body less head BMD (+4.32%, n = 26) and height-age adjusted Z-scores (n = 21; +0.457 for spine, +0.152 for total body less head) were observed at week 144. Five of 81 subjects (6%) had persistent >4% BMD decreases from baseline. Some subjects had virologic responses to TDF plus OBR, and TDF resistance was rare. TDF was well tolerated and can be considered for treatment of HIV-infected adolescents.
Resumo:
Low bone mineral density (BMD) has been found in human immunodeficiency virus (HIV)-infected patients; however, data on associated factors remain unclear, specifically in middle-aged women. This study aims to evaluate factors associated with low BMD in HIV-positive women. In this cross-sectional study, a questionnaire was administered to 206 HIV-positive women aged 40 to 60 years who were receiving outpatient care. Clinical features, laboratory test results, and BMD were assessed. Yates and Pearson χ(2) tests and Poisson multiple regression analysis were performed. The median age of women was 47.7 years; 75% had nadir CD4 T-cell counts higher than 200, and 77.8% had viral loads below the detection limit. There was no association between low BMD at the proximal femur and lumbar spine (L1-L4) and risk factors associated with HIV infection and highly active antiretroviral therapy. Poisson multiple regression analysis showed that the only factor associated with low BMD at the proximal femur and lumbar spine was postmenopause status. Low BMD is present in more than one third of this population sample, in which most women are using highly active antiretroviral therapy and have a well-controlled disease. The main associated factor is related to estrogen deprivation. The present data support periodic BMD assessments in HIV-infected patients and highlight the need to implement comprehensive menopausal care for these women to prevent bone loss.
Resumo:
This study investigated the presence of target bacterial species and the levels of endotoxins in teeth with apical periodontitis. Levels of inflammatory mediators (interleukin [IL]-1β and tumor necrosis factor [TNF]-α) were determined after macrophage stimulation with endodontic content after different phases of endodontic therapy using different irrigants. Thirty primarily infected root canals were randomly assigned into 3 groups according to the irrigant used for root canal preparation (n = 10 per group): GI: 2.5% sodium hypochlorite, GII: 2% chlorhexidine gel, and GIII (control group): saline solution. Root canal samples were taken by using paper points before (s1) and after root canal instrumentation (s2), subsequently to 17% EDTA (s3), after 30 days of intracanal medication (Ca[OH]2 + saline solution) (s4), and before root canal obturation (s5). Polymerase chain reaction (16S recombinant DNA) and limulus amebocyte lysate assay were used for bacterial and endotoxin detection, respectively. Macrophages were stimulated with the root canal contents for IL-1β/TNF-α measurement using enzyme-linked immunosorbent assay. Porphyromonas gingivalis (17/30), Porphyromonas endodontalis (15/30), and Prevotella nigrescens (11/30) were the most prevalent bacterial species. At s1, endotoxins were detected in 100% of the root canals (median = 32.43 EU/mL). In parallel, substantial amounts of IL-1β and TNF-α were produced by endodontic content-stimulated macrophages. At s2, a significant reduction in endotoxin levels was observed in all groups, with GI presenting the greatest reduction (P < .05). After a root canal rinse with EDTA (s3), intracanal medication (s4), and before root canal obturation (s5), endotoxin levels reduced without differences between groups (P < .05). IL-1β and TNF-α release decreased proportionally to the levels of residual endotoxin (P < .05). Regardless of the use of sodium hypochlorite or CHX, the greatest endotoxin reduction occurs after chemomechanical preparation. Increasing steps of root canal therapy associated with intracanal medication enhances endotoxin reduction, leading to a progressively lower activation of proinflammatory cells such as macrophages.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
From 1992 to 1995 we studied 232 (69% male, 87% Caucasian) anti-human immunodeficiency virus (anti-HIV) positive Brazilian patients, through a questionnaire; HIV had been acquired sexually by 50%, from blood by 32%, sexually and/or from blood by 16.4% and by an unknown route by 1.7%. Intravenous drug use was reported by 29%; it was the most important risk factor for HIV transmission. The alanine aminotransferase quotient (qALT) was >1 for 40% of the patients, 93.6% had anti-hepatitis A virus antibody, 5.3% presented hepatitis B surface antigen, 44% were anti-hepatitis B core antigen positive and 53.8% were anti-hepatitis C virus (anti-HCV) positive. The anti-HCV test showed a significant association with qALT>1. Patients for whom the probable HIV transmission route was blood had a 10.8 times greater risk of being anti-HCV positive than patients infected by other routes. Among 30 patients submitted to liver biopsy, 18 presented chronic hepatitis.
Resumo:
The esthetics and functional integrity of the periodontal tissue may be compromised by dental loss. Immediate implants became a viable option to maintain the periodontal architecture because of their anatomic compatibility with the dental socket and the possibility of eliminating local contamination. This article describes the procedure of immediate implant placement in the anterior maxilla replacing teeth with chronic periapical lesions, which were condemned due to endodontic lesions persisting after failed endodontic treatment and endodontic surgery, and discusses the relationship between the procedure and periapical lesions. Surgical removal of hopeless teeth 11, 12 and 21 was performed conservatively in such a way to preserve the anatomy and gingival esthetics. A second surgical access was gained at the apical level, allowing the debridement of the surgical chamber for elimination of the periapical lesion, visual orientation for setting of the implants and filling of the surgical chamber with xenogenous bovine bone graft. After this procedure, the bone chamber was covered with an absorbent membrane and the healing screws were positioned on the implants. Later, a provisional partial removable denture was installed and the implants were inserted after 6 months. After 3 years of rehabilitation, the implants present satisfactory functional and esthetic conditions, suggesting that immediate implant placement combined with guided bone regeneration may be indicated for replacing teeth lost due to chronic periapical lesions with endodontic failure history in the anterior maxilla.
Resumo:
The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.
Resumo:
There is a little-noticed trend involving human immunodeficiency virus (HIV)-infected patients suspected of having tuberculosis: the triple-treatment regimen recommended in Brazil for years has been potentially ineffective in over 30% of the cases. This proportion may be attributable to drug resistance (to at least 1 drug) and/or to infection with non-tuberculous mycobacteria. This evidence was not disclosed in official statistics, but arose from a systematic review of a few regional studies in which the diagnosis was reliably confirmed by mycobacterial culture. This paper clarifies that there has long been ample evidence for the potential benefits of a four-drug regimen for co-infected patients in Brazil and it reinforces the need for determining the species and drug susceptibility in all positive cultures from HIV-positive patients.
Resumo:
The Indirect Fluorescence Assay (IFA) and the indirect ELISA were comparatively used to detect IgG and IgM antibodies for Toxoplasma gondii in experimentally and naturally infected primates. In the experimentally infected group, antibodies of diagnostic value were detected at day 9 post-infection (PI) with the IFA (IgG and IgM) and with IgG-ELISA. IgM-ELISA detected antibodies for T. gondii starting at day 3 PI until the end of the experiment (102 days PI). Of the 209 naturally infected sera tested, from many zoos of State of Sao Paulo, 64.59 and 67.94% were positive in the IgG-IFA test and IgG-ELISA respectively. IgM-ELISA test detected seropositivity in 52.63% of the sera although IgM-IFA test detected it in only in 0.96% of the samples. The differential toxoplasmosis diagnosis was accomplished with Neospora caninum by IFA, observing 61 (29.2%) seropositive animals for this parasite and 149 (70.8%) negative. Sixty animals were positive for both T. gondii and N. caninum. Pneumonia, splenomegaly, and intestinal ulcers were macroscopically observed. Unremarkable interstitial pneumonia, enteritis, colitis, splenitis, and glomerulitis were microscopically observed. The immunohistochemical stain could not detect the presence of T. gondii in the tissues of the animals infected experimentally.
Resumo:
Cryptosporidium spp. are important cause of enteric disease in humans, but may also infect animals. This study describes the relative frequency of several Cryptosporidium species found in human specimens from HIV infected patients in the São Paulo municipality obtained from January to July 2007. Sequence analysis of the products of nested-PCR based on small subunit rRNA and Cryptosporidium oocyst wall protein coding genes revealed 17 (63.0%) isolates of C. hominis, four (14.8%) C. parvum, five (18.5%) C. felis and one (3.7%) C. canis. These findings suggest that, in urban environments of Brazil, the cat adapted C. felis may play a potential role in the zoonotic transmission of cryptosporidiosis whereas the anthroponotic transmission of cryptosporidiosis caused by C. hominis seems to predominate.
Resumo:
To identify natural infections by Leishmania spp. in insect vectors of cutaneous and visceral leishmaniasis, we performed field studies in natural and anthropic environments in the Guaicurus Settlement (Bodoquena Range) of the Bonito municipality, Mato Grosso do Sul state, Brazil. From October 2002 to October 2003, a total of 1395 sandfly females were captured with Shannon and light traps and dissected in search of flagellates. The sample is composed of a total of 13 species, with Lutzomyia almerioi (59.9%) and Lutzomyia longipalpis (31.4%) predominant. Infections by flagellates were directly observed in three of the dissected of Lu. almerioi females (0.36%). To increase the sensitivity of detection, DNA extracted from pools of the 1220 dissected females (Lu. almerioi 808, Lu. longipalpis 399 and Nyssomyia whitmani 13) was subjected to small subunit rRNA-based polymerase chain reactions (SSU-PCR). DNA from Leishmania (L.) infantum chagasi was detected in at least 0.37% of Lu. almerioi females and in 0.25% of Lu. longipalpis females. The DNA of the Leishmania (Viannia) sp. was detected in 0.12% of Lu. almerioi and in 0.70% of Lu. longipalpis. Leishmania (L.) amazonensis was found in 1.25% of Lu. longipalpis. Mixed infections of L. (Leishmania) sp. and L. (Viannia) sp. were found in 0.50% of Lu. longipalpis. When considering that each positive pool contained at least a single infected specimen, we found a 1.23% rate of Leishmania spp. infection among the total population of dissected female sand flies as determined by PCR. This is the first report of natural infection by L. (L.) infantum chagasi and L. (Viannia) sp. in Lu. almerioi. It is also the first report of infection by L. (Viannia) sp. in Lu. longipalpis. The observation that Lu. longipalpis and Lu. almerioi are naturally infected by agents of both cutaneous and visceral leishmaniases suggests that these two species play a role in the transmission (continua) (continuação) of these diseases within the study area. Furthermore, the finding that Lu. longipalpis has been naturally infected by L. (L.) amazonensis and L. (Viannia) sp., and Lu. almerioi by L. (L.) infantum chagasi and L. (Viannia), suggests their participation as permissive vectors
Resumo:
Trypanosoma cruzi. The aim of this work was to analyze histologically and histometrically the sublingual gland of mice infected with the RAL strain of T cruzi, according to the sex. Swiss mice (Mus musculus) were inoculated with 2 x 10(4) blood trypomastigotes of the RAL strain of T cruzi. In the peak of the parasitemia (12th day) the mice were sacrificed, and the sublingual glands were fixed in ALFAC. HE-stained histological sections were evaluated histometrically. The parasitemia was higher in females. Histopatologically, acini of the infected animals were smaller, with scanty production of secretion, and smaller striated ducts. The nuclei of the demilunes were smaller and showed amastigote nests in the cytoplasm. Karyometrically, nuclei of the acini, demilunes and striated ducts were smaller in the infected mice. Stereologically, it was observed that relative volumes of acini and ducts were smaller and, inversely, relative volumen were greater for the conjunctive tissue in the infected males. The surface densities of acini and ducts were bigger and the diameter and thickness of the wall were smaller in this group. On the other hand, relative volume of acini was smaller and those of the ducts and conjunctive tissue were bigger in the infected females. The diameter and thickness of the wall of acini were smaller, and those of the striated ducts were bigger in this group. The RAL strain of T cruzi caused general atrophy in the sublingual gland, with numerous nests of parasites in the glandular parenchyma.
Resumo:
Background: HIV-1-infected individuals who spontaneously control viral replication represent an example of successful containment of the AIDS virus. Understanding the anti-viral immune responses in these individuals may help in vaccine design. However, immune responses against HIV-1 are normally analyzed using HIV-1 consensus B 15-mers that overlap by 11 amino acids. Unfortunately, this method may underestimate the real breadth of the cellular immune responses against the autologous sequence of the infecting virus. Methodology and Principal Findings: Here we compared cellular immune responses against nef and vif-encoded consensus B 15-mer peptides to responses against HLA class I-predicted minimal optimal epitopes from consensus B and autologous sequences in six patients who have controlled HIV-1 replication. Interestingly, our analysis revealed that three of our patients had broader cellular immune responses against HLA class I-predicted minimal optimal epitopes from either autologous viruses or from the HIV-1 consensus B sequence, when compared to responses against the 15-mer HIV-1 type B consensus peptides. Conclusion and Significance: This suggests that the cellular immune responses against HIV-1 in controller patients may be broader than we had previously anticipated.
Resumo:
Background: The results of previous studies elsewhere have indicated that GB virus C (GBV-C) infection is frequent in patients infected with the human immunodeficiency virus type 1 (HIV-1) due to similar transmission routes of both viruses. The aim of this study was to determine the prevalence, incidence density and genotypic characteristics of GBV-C in this population. Methodology/Principal Findings: The study population included 233 patients from a cohort primarily comprised of homosexual men recently infected with HIV-1 in Sao Paulo, Brazil. The presence of GBV-C RNA was determined in plasma samples by reverse transcriptase-nested polymerase chain reaction and quantified by real-time PCR. GBV-C genotypes were determined by direct sequencing. HIV viral load, CD4+ T lymphocyte and CD8+ T lymphocyte count were also tested in all patients. The overall prevalence of GBV-C infection was 0.23 (95% CI: 0.18 to 0.29) in the study group. There was no significant difference between patients with and without GBV-C infection and Glycoprotein E2 antibody presence regarding age, sex, HIV-1 viral load, CD4+ and CD8+ T cell counts and treatment with antiretroviral drugs. An inverse correlation was observed between GBV-C and HIV-1 loads at enrollment and after one year. Also, a positive but not significant correlation was observed between GBV-C load and CD4+ T lymphocyte. Phylogenetic analysis of the GBV-C isolates revealed the presence of genotype 1 and genotype 2, these sub classified into subtype 2a and 2b. Conclusion/Significance: GBV-C infection is common in recently HIV -1 infected patients in Sao Paulo, Brazil and the predominant genotype is 2b. This study provides the first report of the GBV-C prevalence at the time of diagnosis of HIV-1 and the incidence density of GBV-C infection in one year.