BODE Index and GOLD Staging as Predictors of 1-Year Exacerbation Risk in Chronic Obstructive Pulmonary Disease

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Ventilation Patterns Influence Airway Secretion Movement

BACKGROUND: Retention of airway secretions is a common and serious problem in ventilated patients. Treating or avoiding secretion retention with mucus thinning, patient-positioning, airway suctioning, or chest or airway vibration or percussion may provide short-term benefit. METHODS: In a series of laboratory experiments with a test-lung system we examined the role of ventilator settings and lung-impedance on secretion retention and expulsion. Known quantities of a synthetic dye-stained mucus simulant with clinically relevant properties were injected into a transparent tube the diameter of an adult trachea and exposed to various mechanical-ventilation conditions. Mucus-simulant movement was measured with a photodensitometric technique and examined with image-analysis software. We tested 2 mucus-simulant viscosities and various peak flows, inspiratory/ expiratory flow ratios, intrinsic positive end-expiratory pressures, ventilation waveforms, and impedance values. RESULTS: Ventilator settings that produced flow bias had a major effect on mucus movement. Expiratory How bias associated with intrinsic positive end-expiratory pressure generated by elevated minute ventilation moved mucus toward the airway opening, whereas intrinsic positive end-expiratory pressure generated by increased airway resistance moved the mucus toward the lungs. Inter-lung transfer of mucus simulant occurred rapidly across the ""carinal divider"" between interconnected test lungs set to radically different compliances; the mucus moved out of the low-compliance lung and into the high-compliance lung. CONCLUSIONS: The movement of mucus simulant was influenced by the ventilation pattern and lung impedance. Flow bias obtained with ventilator settings may clear or embed mucus during mechanical ventilation.

Reabilitação respiratória na DPOC : efeito de duas intensidades de treino de exercício aeróbio nos resultados centrados no doente

RESUMO: Introdução: O treino de exercício assume uma importância fundamental nos programas de reabilitação respiratória, contudo permanece desconhecida qual a intensidade de treino efectiva na mudança dos resultados centrados no doente. Objectivos: Foram estudados os efeitos de duas intensidades de treino aeróbio na qualidade de vida relacionada com a saúde, no controlo de sintomas e na tolerância ao exercício, num programa de reabilitação respiratória para doentes com DPOC. Métodos: Trinta e quatro doentes com DPOC de estádios GOLD de ligeiro a muito grave, foram alocados aleatoriamente a intensidades de treino de exercício aeróbio de 60% ou 80% da intensidade máxima avaliada na prova de esforço num programa ambulatório de reabilitação respiratória de 20 sessões. Foram avaliados resultados centrados no doente pela aplicação do questionário respiratório de St.George, do índice de dispneia de Mahler, do questionário de actividades da vida diária do London Chest, da prova de 6 minutos, da prova de endurance a carga constante e da prova de esforço máxima incremental. Resultados: Apesar de existirem melhorias significativas em todos os resultados para ambos os grupos, a diferença média intergrupal por efeito da intensidade de treino aeróbio a 60% ou 80% da carga máxima em prova de esforço não foi significativa no questionário respiratório de St.George (p=0,306), no índice de dispneia de Mahler (p=0,378), no questionário de actividades da vida diária do London Chest (p=0,425), na prova de marcha de 6 minutos (p=0,917), na prova de endurance a carga constante (p=0,504) e na prova de esforço máxima incremental (p=0,117). Verificou-se ainda que a média das diferenças intergrupais na prova de endurance a carga constante e na prova de marcha de 6 minutos não apresentou qualquer associação com a idade dos doentes. Conclusões: O estudo permite concluir que não existem diferenças significativas nas alterações médias da qualidade de vida relacionada com a saúde, do controle de sintomas e da tolerância ao exercício em doentes com DPOC como efeito de duas intensidades de treino aeróbio. Os autores propõem para a prática clínica em reabilitação respiratória, a aplicação de intensidades de treino aeróbio individualmente adaptadas, de pelo menos 60% da carga máxima na prova de esforço inicial. -------------------------------ABSTRACT: Introduction: Exercise training is an important component of pulmonary rehabilitation, but it remains questionable as how training intensity changes patient-centered outcomes. Aims and objectives: The effects of two aerobic exercise training intensities in health-related quality of life, symptoms control and exercise tolerance in COPD patients were studied. Methods: Thirty-four COPD patients from mild to very severe GOLD stages were randomly assigned to a 60% or 80% aerobic exercise training intensity in a twenty-session outpatient pulmonary rehabilitation program. Patient-centered outcomes were assessed with St.George's respiratory questionnaire, Mahler dyspnoea index, London Chest activity of daily living, six minute walk test, constant work rate test and maximal incremental test. Results: Although there were significant improvements in all outcomes for both groups, there were no differences in mean change in St.George's respiratory questionnaire (p=0,306), Mahler dyspnoea index (p=0,378), London Chest activity of daily living (p=0,917), six-minute walk test (p=0,504), constant work rate test (p=0,504) and maximal incremental test (p=0,117), as an effect of aerobic exercise training intensity of 60% or 80%. Mean changes in constant work rate and six-minute walk test were not age-related. Conclusions: It is concluded that there are no differences in mean changes in health-related quality of life, symptoms control and exercise tolerance in COPD patients as an effect of two aerobic exercise training intensities. Therefore, the authors suggest that individually tailored exercise intensities above 60% should guide clinical practice in pulmonary rehabilitation.

Susceptibility to exacerbation in chronic obstructive pulmonary disease

Background Although we know that exacerbations are key events in chronic obstructive pulmonary disease (COPD), our understanding of their frequency, determinants, and effects is incomplete. In a large observational cohort, we tested the hypothesis that there is a frequent-exacerbation phenotype of COPD that is independent of disease severity. Methods We analyzed the frequency and associations of exacerbation in 2138 patients enrolled in the Evaluation of COPD Longitudinally to Identify Predictive Surrogate End points (ECLIPSE) study. Exacerbations were defined as events that led a care provider to prescribe antibiotics or corticosteroids (or both)or that led to hospitalization (severe exacerbations). Exacerbation frequency was observed over a period of 3 years. Results Exacerbations became more frequent (and more severe) as the severity of COPD increased; exacerbation rates in the first year of follow-up were 0.85 per person for patients with stage 2 COPD (with stage defined in accordance with Global Initiative for Chronic Obstructive Lung Disease [GOLD] stages), 1.34 for patients with stage 3, and 2.00 for patients with stage 4. Overall, 22% of patients with stage 2 disease, 33% with stage 3, and 47% with stage 4 had frequent exacerbations (two or more in the first year of follow-up). The single best predictor of exacerbations, across all GOLD stages, was a history of exacerbations. The frequent-exacerbation phenotype appeared to be relatively stable over a period of 3 years and could be predicted on the basis of the patient"s recall of previous treated events. In addition to its association with more severe disease and prior exacerbations, the phenotype was independently associated with a history of gastroesophageal reflux or heartburn, poorer quality of life, and elevated white-cell count. Conclusions Although exacerbations become more frequent and more severe as COPD progresses, the rate at which they occur appears to reflect an independent susceptibility phenotype. This has implications for the targeting of exacerbation-prevention strategies across the spectrum of disease severity. (Funded by GlaxoSmithKline; ClinicalTrials .gov number, NCT00292552.)

Association of MMP-2 polymorphisms with severe and very severe COPD: a case control study of MMPs-1, 9 and 12 in a European population.

BACKGROUND: Genetic factors play a role in chronic obstructive pulmonary disease (COPD) but are poorly understood. A number of candidate genes have been proposed on the basis of the pathogenesis of COPD. These include the matrix metalloproteinase (MMP) genes which play a role in tissue remodelling and fit in with the protease--antiprotease imbalance theory for the cause of COPD. Previous genetic studies of MMPs in COPD have had inadequate coverage of the genes, and have reported conflicting associations of both single nucleotide polymorphisms (SNPs) and SNP haplotypes, plausibly due to under-powered studies. METHODS: To address these issues we genotyped 26 SNPs, providing comprehensive coverage of reported SNP variation, in MMPs- 1, 9 and 12 from 977 COPD patients and 876 non-diseased smokers of European descent and evaluated their association with disease singly and in haplotype combinations. We used logistic regression to adjust for age, gender, centre and smoking history. RESULTS: Haplotypes of two SNPs in MMP-12 (rs652438 and rs2276109), showed an association with severe/very severe disease, corresponding to GOLD Stages III and IV. CONCLUSIONS: Those with the common A-A haplotype for these two SNPs were at greater risk of developing severe/very severe disease (p = 0.0039) while possession of the minor G variants at either SNP locus had a protective effect (adjusted odds ratio of 0.76; 95% CI 0.61 - 0.94). The A-A haplotype was also associated with significantly lower predicted FEV1 (42.62% versus 44.79%; p = 0.0129). This implicates haplotypes of MMP-12 as modifiers of disease severity.

Dynamics of chest wall volume regulation during constant work rate exercise in patients with chronic obstructive pulmonary disease

This study evaluated the dynamic behavior of total and compartmental chest wall volumes [(V CW) = rib cage (V RC) + abdomen (V AB)] as measured breath-by-breath by optoelectronic plethysmography during constant-load exercise in patients with stable chronic obstructive pulmonary disease. Thirty males (GOLD stages II-III) underwent a cardiopulmonary exercise test to the limit of tolerance (Tlim) at 75% of peak work rate on an electronically braked cycle ergometer. Exercise-induced dynamic hyperinflation was considered to be present when end-expiratory (EE) V CW increased in relation to resting values. There was a noticeable heterogeneity in the patterns of V CW regulation as EEV CW increased non-linearly in 17/30 "hyperinflators" and decreased in 13/30 "non-hyperinflators" (P < 0.05). EEV AB decreased slightly in 8 of the "hyperinflators", thereby reducing and slowing the rate of increase in end-inspiratory (EI) V CW (P < 0.05). In contrast, decreases in EEV CW in the "non-hyperinflators" were due to the combination of stable EEV RC with marked reductions in EEV AB. These patients showed lower EIV CW and end-exercise dyspnea scores but longer Tlim than their counterparts (P < 0.05). Dyspnea increased and Tlim decreased non-linearly with a faster rate of increase in EIV CW regardless of the presence or absence of dynamic hyperinflation (P < 0.001). However, no significant between-group differences were observed in metabolic, pulmonary gas exchange and cardiovascular responses to exercise. Chest wall volumes are continuously regulated during exercise in order to postpone (or even avoid) their migration to higher operating volumes in patients with COPD, a dynamic process that is strongly dependent on the behavior of the abdominal compartment.

[Pilot Project: Improved Lung Deposition via a New Nasal Inhalation Procedure].

INTRODUCTION Inhaled drugs can only be effective if they reach the middle and small airways. This study introduces a system that combines a trans-nasal application of aerosols with noninvasive pressure support ventilation. METHODS In a pilot study, 7 COPD patients with GOLD stages II and III inhaled a radiolabeled marker dissolved in water via a trans-nasal route. The mean aerosol particle size was 5.5 µm. Each patient took part in two inhalation sessions that included two application methods and were at least 70 hours apart. During the first session ("passive method"), the patient inhaled the aerosol through an open tube system. The second session ("active method") included pressure support ventilation during the inhalation process. A gamma camera and planar scintigraphy was used to determine the distribution of aerosol particles in the patient's body and lung. RESULTS The pressure supported inhalation ("active method") results in an increased aerosol lung deposition compared to the passive method. Above all, we could demonstrate deposition in the lung periphery with relatively large aerosol particles (5.5 µm). DISCUSSION The results prove that the combination of trans-nasal inhalation with noninvasive pressure support ventilation leads to significantly increased particle deposition in the lung.

Catalytic oxidation of ethanol on gold electrode in alkaline media

This work presents a study of the catalytic oxidation of ethanol on polycrystalline gold electrode in alkaline media. The investigation was carried out by means of chronoamperometry, cyclic voltammetry, and in situ FTIR spectroscopy. The main goal was to investigate the early stages of ethanol electrooxidation, namely at fairly low potentials (E = 600 mV vs. RHE) and for moderate reaction times (t < 300 s). Chronoamperometric experiments show a current increase accompanying the increasing in the ethanol concentration up to about 2 M and then a slight decrease at 3 M. Adsorbed CO has been observed as early as about 200 mV vs. RHE and indicates that the cleavage of the C-C bond might occur, probably to a small extent, at very low overpotentials during ethanol adsorption on gold surface. The amount of dissolved acetate ions produced during the chronoamperomentry was followed by the asymmetric stretching band at 1558 cm(-1) as a function of time, and found to increase linearly with time up to 300 s. This allowed estimating the reaction order of acetate formation with respect to ethanol concentration.

New reconciliation model for gold industry

Reconciliation can be divided into stages, each stage representing the performance of a mining operation, such as: long-term estimation, short-term estimation, planning, mining and mineral processing. The gold industry includes another stage which is the budget, when the company informs the financial market of its annual production forecast. The division of reconciliation into stages increases the reliability of the annual budget informed by the mining companies, while also detecting and correcting the critical steps responsible for the overall estimation error by the optimization of sampling protocols and equipment. This paper develops and validates a new reconciliation model for the gold industry, which is based on correct sampling practices and the subdivision of reconciliation into stages, aiming for better grade estimates and more efficient control of the mining industry`s processes, from resource estimation to final production.

Magnetometric exploration in intrusive basic with evidence of gold in northern region of the Camaquã Sedimentary Basin (RS)

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Geological and geochemical characteristics of the Tersang gold deposit, Malaysia: implications for genesis and gold exploration

The Central gold belt of peninsular Malaysia comprises a number of gold deposits located in the east of the N-S striking Bentong-Raub Suture Zone. The Tersang gold deposit is one of the gold deposits in the gold belt and hosted in sandstone, rhyolite and breccia units. The deposit has an inferred resource of 528,000 ounces of gold. The geochronology of the Tersang deposit has been newly constrained by LA ICP-MS U-Pb zircon dating. The maximum depositional age of the host sedimentary rocks ranges from Early Carboniferous to Early Permian (261.5 ± 4.9 Ma to 333.5 ± 2.5 Ma) for the host sandstone and Late Triassic for the rhyolite intrusion (218.8 ± 1.7 Ma). Textural characteristics of pyrite have revealed five types including (1) Euhedral to subhedral pyrite with internal fracturing and porous cores located in the sandstone layers (pyrite 1); (2) Anhedral pyrite overgrowths on pyrite 1 and disseminated in stage 1 vein (pyrite 2); (3) Fracture-filled or vein pyrite located in stages 1 and 2 vein (pyrite 3); (4) Euhedral pyrite with internal fractures also located in stage 2 vein (pyrite 4); and (5) Subhedral clean pyrite located in the rhyolite intrusion (pyrite 5). Based on pyrite mapping and spot analyses, two main stages of gold enrichment are documented from the Tersang gold deposit. Gold in sandstone-hosted pyrite 1 (mean 4.3 ppm) shows best correlation with Bi and Pb (as evidenced on pyrite maps). In addition, gold in pyrite 3 (mean 8 ppm) located in stage 2 vein shows a good correlation with As, Ag, Sb, Cu, Tl, and Pb. In terms of gold exploration, we suggest that elements such as As, Ag, Sb, Cu, Tl, Bi, and Pb associated with Au may serve as vectoring tools in gold exploration. Our new geological, structural, geochemical and isotopic data together with mineral paragenesis, pyrite chemistry and ore fluid characteristics indicate that the Tersang gold deposit is comparable to a sediment-hosted gold deposit. Our new genetic model suggests deposition of the Permo-Carboniferous sediments followed by intrusion of rhyolitic magma in the Late Triassic. At a later stage, gold mineralisation overprinted the rhyolite intrusion and the sandstone.

Bajo de la Alumbrera copper-gold deposit: Stable isotope evidence for a porphyry-related hydrothermal system dominated by magmatic aqueous fluids

Alteration zones at the gold-rich Bajo de la Alumbrera porphyry copper deposit in northwestern Argentina are centered on several porphyritic intrusions. They are zoned from a central copper-iron sulfide and gold-mineralized potassic (biotite-K-feldspar +/- quartz) core outward to propylitic (chlorite-illite-epidote-calcite) assemblages. A mineralized intermediate argillic alteration assemblage (chlorite-illite +/- pyrite) has overprinted the potassic alteration zone across the top and sides of the deposit and is itself zoned outward into phyllic (quartzinuscovite-illite +/- pyrite) alteration. This study contributes new data to previously reported delta(18)O and delta D compositions of fluids responsible for the alteration at Bajo de la Alumbrera, and the data are used to infer likely ore-forming processes. Measured and calculated delta(18)O and delta D values of fluids (+8.3 to +10.2 and -33 to -81 parts per thousand, respectively) confirm a primary magmatic origin for the earliest potassic alteration phase. Lower temperature potassic alteration formed from magmatic fluids with lower delta D values (down to -123 parts per thousand). These depleted compositions are distinct from meteoric water and consistent with degassing and volatile exsolution of magmatic fluids derived from an underlying magma. Variability in the calculated composition of fluid associated with potassic alteration is explained in terms of phase separation (or boiling). if copper-iron sulfide deposition occurred during cooling (as proposed elsewhere), this cooling was largely a result of phase separation. Magmatic water was directly involved in the formation of overprinting intermediate argillic alteration assemblages at Bajo de la Alumbrera. Calculated delta(18)O and delta D values of fluids associated with this alteration range from +4.8 to +8.1 and -31 to -71 per mil, respectively Compositions determined for fluids associated with phyllic alteration (-0.8 to +10.2 and -31 to -119 parts per thousand) overlap with the values determined for the intermediate argillic alteration. We infer that phyllic alteration assemblages developed during two stages; the first was a high-temperature (400 degrees-300 degrees C) stage with D-depleted water (delta D = -66 to -119 parts per thousand). This compositional range may have resulted from magma degassing and/or the injection of new magmatic water into a compositionally evolved hydrothermal system. The isotopic variations also can be explained by increased fluid-rock interaction. The second stage of phyllic alteration occurred at a lower temperature (similar to 200 degrees C), and variations in the modeled isotopic compositions imply mixing of magmatic and meteoric waters. Ore deposition that occurred late in the evolution of the hydrothermal system was probably associated with further cooling of the magmatic fluid, in part caused by fluid-rock interaction and phase separation. Changing pH and/or oxygen fuoracity may have caused additional ore deposition. The ingress of meteoric water appears to postdate the bulk of mineralization and occurred as the system at Bajo de la Alumbrera waned.

Gold mineralisation in the Caledonides of the British Isles with special reference to the Dolgellau Gold-belt, North Wales and the Southern Uplands, Scotland. Available in 2 volumes.

Two aspects of gold mineralisation in the Caledonides of the British Isles have been investigated: gold-telluride mineralisation at Clogau Mine, North Wales; and placer gold mineralisation in the Southern Uplands, Scotland. The primary ore assemblage at Clogau Mine is pyrite, arsenopyrite, cobaltite, pyrrhotine, chalcopyrite, galena, tellurbismuth, tetradymite, altaite, hessite, native gold, wehrlite, hedleyite, native bismuth, bismuthunite and various sulphosalts. The generalised paragenesis is early Fe, Co, Cu, As and S species, and later minerals of Pb, Bi, Ag, Au, Te, Sb. Electron probe micro-analysis (EPMA) of complex telluride-sulphide intergrowths suggests that these intergrowths formed by co-crystallisation/replacement processes and not exsolution. Minor element chemical variation, in the sulphides and tellurides, indicates that antimony and cadmium are preferentially partitioned into telluride minerals. Mineral stability diagrams suggest that during gold deposition log bf aTe2 was between -7.9 and -9.7 and log bf aS2 between -12.4 and -13.8. Co-existing mineral assemblages indicate that the final stages of telluride mineralisation were between c. 250 - 275oC. It is suggested that the high-grade telluride ore shoot was the result of remobilisation of Au, Bi, Ag and Te from low grade mineralisation elsewhere within the vein system, and that gold deposition was brought about by destabilisation of gold chloride complexes by interaction with graphite, sulphides and tellurbismuth. Scanning electron microscopy of planer gold grains from the Southern Uplands, Scotland, indicates that detailed studies on the morphology of placer gold can be used to elucidate the history of gold in the placer environment. In total 18 different morphological characteristics were identified. These were divided on an empirical basis, using the relative degree of mechanical attrition, into proximal and distal characteristics. One morphological characteristic (a porous/spongy surface at high magnification) is considered to be chemical in origin and represent the growth of `new' gold in the placer environment. The geographical distribution of morphological characteristics has been examined and suggests that proximal placer gold is spatially associated with the Loch Doon, Cairsphairn and Fleet granitoids. Quantitative EPMA of the placer gold reveals two compositional populations of placer gold. Examination of the geographical distribution of fineness suggests a loose spatial association between granitoids and low fineness placer gold. Also identified was chemically heterogeneous placer gold. EPMA studies of these heterogeneities allowed estimation of annealing history limits, which suggest that the heterogeneities formed between 150 and 235oC. It is concluded, on the basis of relationships between morphology and composition, that there are two types of placer gold in the Southern Uplands: (i) placer gold which is directly inherited from a hypogene source probably spatially associated with granitoids; and (ii) placer gold that has formed during supergene processes.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Immature stages of the moth Lobeza dentilinea (Lepidoptera: Notodontidae), with redescription of the species based on male and female morphology

Egg and pupa of Lobeza dentilinea Schaus, 1901 are described and illustrated for the first time. Eggs are smooth, dome-shaped, and greenish at oviposition. Last instar larvae have an aposematic coloration and the chaetotaxy is very similar to other notodontines, except for the number of lateral setae: L. dentilinea has three instead of four lateral setae on abdominal segments A3-A6. Pupae are light brown and typical of the family, with the last abdominal segments broadly round. Evidence from the adult morphology supporting the placement of the genus in Notodontinae includes proboscis smaller than the length of the head, epiphysis with more than half the length of tibia, tarsal claws simple, and labial palpi short. Male and female are confidently associated, and a redescription of the species is presented based on both sexes. Larvae of L. dentilinea are here recorded feeding on a Melastomataceae.