Fly pollination and pollinator sharing in two synchronopatric species: Cordia multispicata (Boraginaceae) and Borreria alata (Rubiaceae)

The floral biology of Cordia multispicata (Boraginaceae) and Borreria alata (Rubiaceae) was studied in natural populations in a fragment of the Atlantic forest in Pernambuco, northeastern Brazil. Both species flower during almost the whole year. Cordia multispicata is a shrubby species with white, distylous and tubular flowers. Borreria alata is a herbaceous species. Its flowers are whitish, tubular and have a polymorphism in relation to the size of their style. Floral anthesis in both species begins at 6:00 a.m. Sugar concentration in the nectar was about 16% in C. multispicata and 30% in B. alata. Nine species of flies, mainly of the genus Palpada (Syrphidae), were observed visiting flowers of the two species. Seven of them were observed visiting and pollinating flowers of both C. multispicata and B. alata. Two species visited only flowers of C. multispicata, whereas no fly was exclusive to B. alata flowers. Both species have similar flower morphology, flowering time, habitats in the forest and establish populations very close to each other. These facts can favour the pollinators’ sharing and increase pollinator attraction.

Differentiation of floral color and odor in two fly pollinated species of Metrodorea (Rutaceae) from Brazil

We investigated if differences in morphological characters in two species of Metrodorea (Rutaceae) from Brazilian semideciduous forests correspond to some pollination divergence. M. nigra and M. stipularis are sympatric species, display a similar floral morphology, are protandrous, self-incompatible, their flower periods overlap, and both are pollinated by flies. M. nigra main pollinators are Pseudoptiloleps nigripoda (Muscidae) and Fannia sp. (Fanniidae); M. stipularis major pollinators are Phaenicia eximia (Calliphoridae), Palpada sp. and Ornidia obesa (Syrphidae). The distinct floral odor (disagreeable in M. nigra and sweet in M. stipularis) and color (brownish violet vs. pale yellow) determine the differences on type and number of floral visitors observed. Several species from semideciduous forests initially considered to be pollinated by diverse insects, present flies as main pollinators, stressing the importance of fly pollination in such habitats.

Biologia floral e reprodutiva de Casearia grandiflora Camb. (Flacourtiaceae)

A biologia de reprodução de Casearia grandiflora (Flacourtiaceae) foi estudada em um remanescente de mata mesófila do Parque do Sabiá, Uberlândia - MG. A espécie é importante no sub-bosque de matas da região, florescendo durante quase todo o ano, mas com maior abundância nos meses de março, abril e maio. As flores são branco-esverdeadas com cerca de 7 mm de diâmetro, dispostas em capítulos sésseis axilares. Não apresentam odor perceptível e duram apenas 1 dia. Possuem 10 estames férteis livres entre si e unidos à corola na base. Entre os estames existem estruturas pilosas originárias do receptáculo floral. Os estames e estas estruturas formam um cone em torno do pistilo, onde se acumula o néctar. A antese ocorre de forma irregular, principalmente no início da manhã. O néctar é relativamente abundante (4 miL) e com concentração média de 38% de equivalentes de sacarose. O pólen é liberado nas horas mais quentes do dia, com alta viabilidade (96,6%). Neste horário também ocorre a receptividade estigmática. O visitante mais freqüente foi a mosca Ornidia obesa (Syrphidae), que visita as flores durante quase todo o dia, embora tenham sido observados também outros visitantes casuais como abelhas Meliponinae, borboletas e outras moscas não identificadas. Polinizações controladas mostraram que a planta é auto-incompatível e não apomítica. No entanto, foram observados tubos polínicos crescendo até o ovário e penetrando os óvulos em flores autopolinizadas, sugerindo a ocorrência de fenômenos de auto-esterilidade de ação tardia (pós-fertilização) ou depressão de endogamia. A auto-esterilidade em C. grandiflora contrasta com a autogamia observada na maior parte das plantas miófilas e de flores generalistas ocorrendo nas florestas do Brasil central, mas é semelhante aos sistemas de reprodução de outras Flacourtiaceae lenhosas estudadas em florestas Neotropicais.

Reproductive biology and pollination of Govenia utriculata: A syrphid fly orchid pollinated through a pollen-deceptive mechanism

The reproductive biology and pollination mechanisms of Govenia utriculata (Sw.) Lindl. were studied in a mesophytic semideciduous forest at Serra do Japi, south-eastern Brazil. The floral visitors and pollination mechanisms were recorded, and experimental pollinations were carried out to determine the breeding system of this species. Populations of G. utriculata growing at Serra do Japi are exclusively visited and pollinated by two species of hoverflies in the genus Salpingogaster (Diptera: Syrphidae) that are attracted by deceit to the flowers of this orchid species. The lip apex and the column base present small brownish and yellow to orange spots that mimic pollen clusters. Govenia utriculata is self-compatible, but pollinator dependent. Natural fruit set was low (10%), but similar to that of other non-obligatorily autogamous sympatric orchid species that occur at Serra do Japi and of other fly-pollinated orchid species pollinated through deceptive mechanisms.

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

Morphological, ecological and genetic aspects associated with endemism in the Fly Orchid group.

The European genus Ophrys (Orchidaceae) is famous for its insect-like floral morphology, an adaptation for a pseudocopulatory pollination strategy involving Hymenoptera males. A large number of endemic Ophrys species have recently been described, especially within the Mediterranean Basin, which is one of the major species diversity hotspots. Subtle morphological variation and specific pollinator dependence are the two main perceptible criteria for describing numerous endemic taxa. However, the degree to which endemics differ genetically remains a challenging question. Additionally, knowledge regarding the factors underlying the emergence of such endemic entities is limited. To achieve new insights regarding speciation processes in Ophrys, we have investigated species boundaries in the Fly Orchid group (Ophrys insectifera sensu lato) by examining morphological, ecological and genetic evidence. Classically, authors have recognized one widespread taxon (O. insectifera) and two endemics (O. aymoninii from France and O. subinsectifera from Spain). Our research has identified clear morphological and ecological factors segregating among these taxa; however, genetic differences were more ambiguous. Insights from cpDNA sequencing and amplified fragment length polymorphisms genotyping indicated a recent diversification in the three extant Fly Orchid species, which may have been further obscured by active migration and admixture across the European continent. Our genetic results still indicate weak but noticeable phylogeographic clustering that partially correlates with the described species. Particularly, we report several isolated haplotypes and genetic clusters in central and southeastern Europe. With regard to the morphological, ecological and genetic aspects, we discuss the endemism status within the Fly Orchid group from evolutionary, taxonomical and conservation perspectives.

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

Investigating the relationship between pollination strategies and the size-advantage model in zoophilous plants using the reproductive biology of Arum cylindraceum and other European Arum species as case studies

The size-advantage model (SAM) explains the temporal variation of energetic investment on reproductive structures (i.e. male and female gametes and reproductive organs) in long-lived hermaphroditic plants and animals. It proposes that an increase in the resources available to an organism induces a higher relative investment on the most energetically costly sexual structures. In plants, pollination interactions are known to play an important role in the evolution of floral features. Because the SAM directly concerns flower characters, pollinators are expected to have a strong influence on the application of the model. This hypothesis, however, has never been tested. Here, we investigate whether the identity and diversity of pollinators can be used as a proxy to predict the application of the SAM in exclusive zoophilous plants. We present a new approach to unravel the dynamics of the model and test it on several widespread Arum (Araceae) species. By identifying the species composition, abundance and spatial variation of arthropods trapped in inflorescences, we show that some species (i.e. A. cylindraceum and A. italicum) display a generalist reproductive strategy, relying on the exploitation of a low number of dipterans, in contrast to the pattern seen in the specialist A. maculatum (pollinated specifically by two fly species only). Based on the model presented here, the application of the SAM is predicted for the first two and not expected in the latter species, those predictions being further confirmed by allometric measures. We here demonstrate that while an increase in the female zone occurs in larger inflorescences of generalist species, this does not happen in species demonstrating specific pollinators. This is the first time that this theory is both proposed and empirically tested in zoophilous plants. Its overall biological importance is discussed through its application in other non-Arum systems.

Tracking the ghost of coevolution in specific plant-insect interactions : the case of the pollination system between the globeflower Trollius europaeus and seven european Chiastocheta flies

This study aims at understanding the evolutionary processes at work in specialized species interactions. Prom the macroevolutionary perspective, coevolution among specialized taxa was proposed to be one of the major processes generating biodiversity. We challenge this idea from the theoretical and practical perspective and through a literature review and show that the major hypotheses linking coevolutionary process with macroevolutionary patterns do not necessarily predict lineage co diversification and parallel speciation, limit¬ing the utility of the comparative phylogenenetic approach for investigating coevolution¬ary processes. We also point to the rarity of observed long-term coevolutionary dynamics among lineages and propose that coevolution rather occurs in shorter timescales, followed by ecological fitting. Prom the empirical point, we focus on the nursery pollination interaction between the European globeflower Trollius europaeus (Ranunculaceae) and its associated Chiastocheta flies (Anthomyiidae; Diptera) as a model system of evolution and maintenance of special¬ized interactions. The flies are obligate parasites of the seeds, but also pollinate the plant - it was thus proposed that both species are mutually dependent. Contrasting with the paradigm used for two decades of research on this system, we show that the female fitness component of the plant is similar in the populations with and without Chiastocheta. The plant is thus not exclusively dependent on the flies for reproduction. We discuss this result in the context of the factors responsible for the evolution of mutualistic systems. Understanding the evolution of a biological system requires understanding of its phylo- genetic context. Previous studies showed large mismatch between mtDNA phylogeny and morphological taxonomy in Chiastocheta. By using a large set of RAD-sequencing loci, we delineate the species limits that are congruent with morphology, and show that the discordance is best explained by the scenario of mitochondrial capture among fly species. Finally, we examine this system from a phylogeographic perspective, and identify the lack of congruence in spatial genetic structures of the plant and associated insects across their whole geographic range. The flies show lower numbers of spatial genetic groups than the plant, indicating that not all of the plant réfugia were shared by all the fly species or that the migration dynamics homogenized some of the groups. The incongruence in spatial genetic patterns indicates that fly migrations were largely independent from the genetic background of the plant, following rather a scenario of resource tracking, without the signature of coevolutionary process at this scale. Indeed, while the flies require the plant to survive climatic oscillations, the opposite is not true. Eventually, we show that there is no phylogenetic signal of spatial genetic structures, meaning that neither histories nor life- history traits are shared among closely related species and that species are characterized by unique trajectories of their genes. -- Cette étude vise à comprendre les processus évolutifs à l'oeuvre au sein d'interactions en¬tre espèces spécialisées. Du point de vue macroévolutif, la coévolution entre les taxons spécialisée a été considérée comme l'un des principaux processus générateur de biodiversité. Nous contestons cette idée du point de vue théorique et pratique à travers une revue de la littérature. Nous montrons que les hypothèses majeures reliant les processus coévolutifs avec les patterns de diversité au niveau macroévolutif ne prédisent pas nécessairement la co- diversification des lignées et leur spéciation parallèle, ce qui limite l'utilité de l'approche de phylogénie comparative pour étudier les processus coévolutifs . Nous rappelons également le peu d'exemples de dynamique coévolutive à long terme et proposons que la coévolution se produit plutôt dans des intervalles courts, suivis d'ajustements écologiques. Du point empirique, nous nous concentrons sur l'interaction de pollinisation entre le Trolle d'Europe Trollius europaeus (Ranunculaceae) et ses pollinisateurs associés, du genre Chiastocheta (Anthomyiidae; Diptera) en tant que système-modèle pour étudier l'évolution et le maintien des interactions spécialisées. Les mouches sont des parasites obligatoires des semences, mais pollinisent également la plante. Il a donc été proposé que les deux espèces soient mutuellement dépendantes. Contrastant avec le paradigme utilisé pendant deux décennies de recherche sur ce système, nous montrons, que la composante de fitness femelle de la plante est similaire dans les populations avec et sans Chiastocheta. La plante ne dépend donc pas exclusivement de son interaction avec les mouches pour la reproduction. Nous discutons de ce résultat dans le contexte des facteurs responsables de l'évolution des systèmes mutualistes. Comprendre l'évolution d'un système biologique nécessite la compréhension de son con- texte phylogénétique. Des études antérieures ont montré, chez Chiastocheta, de grandes disparités entre les phylogénies obtenues à partir d'ADN mitochondrial et la taxonomie basée sur les critères morphologiques. En utilisant un grand nombre de loci obtenus par RAD-sequencing, nous traçons les limites des espèces, qui concordent avec les car¬actéristiques morphologies, et montrons que la discordance s'explique en fait par un scénario de capture mitochondriale entre espèces de mouches. Enfin, nous examinons le système d'un point de vue phylogéographique, et identi¬fions les incohérences entre structurations génétiques spatiales de la plante et des insectes associés dans toute leur aire de distribution géographique. Les mouches présentent un nombre de groupes génétiques inférieur à la plante, indiquant que tous les refuges de la plante n'étaient pas partagés par toutes les espèces de mouches ou que les dynamiques migratoires ont homogénéisés certains des groupes chez les mouches. Les différences ob¬servées dans les patrons de structuration génétique spatiale indique que les migrations et dispersions des mouches ont été indépendantes du contexte génétique de la plante, et ces dernières ont été uniquement tributaires de la disponibilité des ressources, sans qu'il n'y ait de signature du processus de coévolution à cette échelle. En effet, tandis que les mouches ont besoin de la plante pour survivre aux oscillations climatiques, le contraire n'est pas exact. Finalement, nous montrons qu'il n'y a pas de signal phylogénétique des structurations génétiques spatiales chez les mouches, ce qui signifie que ni l'histoire, ni les traits d'histoire de vie ne sont partagés entre les espèces phylogénétiquement proches et que les espèces sont caractérisées par des trajectoires uniques de leurs gènes.

Developmental Rate Of Immatures Of Two Fly Species Of Forensic Importance: Sarcophaga (liopygia) Ruficornis And Microcerella Halli (diptera: Sarcophagidae).

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Pollination Ecology Of Two Species Of Elleanthus (orchidaceae): Novel Mechanisms And Underlying Adaptations To Hummingbird Pollination.

Relationships among floral biology, floral micromorphology and pollinator behaviour in bird-pollinated orchids are important issues to understand the evolution of the huge flower diversity within Orchidaceae. We aimed to investigate floral mechanisms underlying the interaction with pollinators in two hummingbird-pollinated orchids occurring in the Atlantic forest. We assessed floral biology, nectar traits, nectary and column micromorphologies, breeding systems and pollinators. In both species, nectar is secreted by lip calli through spaces between the medial lamellar surfaces of epidermal cells. Such form of floral nectar secretion has not been previously described. Both species present functional protandry and are self-compatible yet pollinator-dependent. Fruit sets in hand-pollination experiments were more than twice those under natural conditions, evidencing pollen limitation. The absence of fruit set in interspecific crosses suggests the existence of post-pollination barriers between these synchronopatric species. In Elleanthus brasiliensis, fruits resulting from cross-pollination and natural conditions were heavier than those resulting from self-pollination, suggesting advantages to cross-pollination. Hummingbirds pollinated both species, which share at least one pollinator species. Species differences in floral morphologies led to distinct pollination mechanisms. In E. brasiliensis, attachment of pollinaria to the hummingbird bill occurs through a lever apparatus formed by an appendage in the column, another novelty to the knowledge of orchids. In E. crinipes, pollinaria attachment occurs by simple contact with the bill during insertion into the flower tube, which fits tightly around the bill. The novelties described here illustrate the overlooked richness in ecology and morphophysiology in Orchidaceae. This article is protected by copyright. All rights reserved.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae) fruit-fly species and their hybrids

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Sand fly captures with Disney traps in area of occurrence of Leishmania (Leishmania) amazonensis in the state of Mato Grosso do Sul, mid-western Brazil

INTRODUCTION: The work was conducted to study phlebotomine fauna (Diptera: Psychodidae) and aspects of American cutaneous leishmaniasis transmission in a forested area where Leishmania (Leishmania) amazonensis occurs, situated in the municipality of Bela Vista, State of Mato Grosso do Sul, Brazil. METHODS: The captures were conducted with modified Disney traps, using hamster (Mesocricetus auratus) as bait, from May 2004 to January 2006. RESULTS: Ten species of phlebotomine sandflies were captured: Brumptomyia avellari, Brumptomyia brumpti, Bichromomyia flaviscutellata, Evandromyia bourrouli, Evandromyia lenti, Lutzomyia longipalpis, Psathyromyia campograndensis, Psathyromyia punctigeniculata, Psathyromyia shannoni and Sciopemyia sordellii. The two predominant species were Ev bourrouli (57.3%) and Bi flaviscutellata (41.4%), present at all sampling sites. Two of the 36 hamsters used as bait presented natural infection with Leishmania. The parasite was identified as Leishmania (Leishmania) amazonensis. CONCLUSIONS: Analysis of the results revealed the efficiency of Disney traps for capturing Bichromomyia flaviscutellata and the simultaneous presence of both vector and the Leishmania species transmitted by the same can be considered a predictive factor of the occurrence of leishmaniasis outbreaks for the human population that occupies the location.

OFFSPRING IN RESPONSE TO PARENTAL FEMALE DENSITIES IN THE FRUIT FLY PARASITOID DIACHASMIMORPHA LONGICAUDATA (HYMENOPTERA: BRACONIDAE: OPIINAE)

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.