959 resultados para Flower fly


Relevância:

100.00% 100.00%

Publicador:

Resumo:

A new interaction between insects and carnivorous plants is reported from Brazil. Larvae of the predatory flower fly Toxomerus basalis (Diptera: Syrphidae: Syrphinae) have been found scavenging on the sticky leaves of several carnivorous sundew species (Drosera, Droseraceae) in Minas Gerais and São Paulo states, SE Brazil. This syrphid apparently spends its whole larval stage feeding on prey trapped by Drosera leaves. The nature of this plant-animal relationship is discussed, as well as the Drosera species involved, and locations where T. basalis was observed. 180 years after the discovery of this flower fly species, its biology now has been revealed. This is (1) the first record of kleptoparasitism in the Syrphidae, (2) a new larval feeding mode for this family, and (3) the first report of a dipteran that shows a kleptoparasitic relationship with a carnivorous plant with adhesive flypaper traps. The first descriptions of the third instar larva and puparium of T. basalis based on Scanning Electron Microscope analysis are provided.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

On Mho obesa F. (Diptera: Syrphidae) is usually neglected in forensic entomology, although adults are rather frequent on vertebrate carrion. In this study, conducted in southeastern Brazil in 2008, we used two pig carcasses, one killed by cocaine overdose and the other by shooting, to evaluate mainly the possible influences of the type of death on the larval development of O. obesa in the pig remains. We recorded the breeding of 218 adult specimens of this syrphid fly from the carcass killed by shooting, and none from the carcass killed by cocaine. These observations may open a new perspective for the use of O. obesa in forensic studies, considering its breeding preferences and its complete development on vertebrate carrion.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Here, we investigate the geographical constancy in the specificity level of the specialized lure-and-trap pollination antagonism involving the widespread European Arum maculatum and its associated Psychodid pollinators. Until now, studies concurred in demonstrating that one single insect species, Psychoda phalaenoides, efficiently cross-pollinated plants; researches were, however, performed locally in western Europe. In this study we characterize for the first time the flower visitors' composition at the scale of the distribution range of A. maculatum by intensively collecting plants and insects throughout the European continent. We further correlate local climatic characteristics with the community composition of visiting arthropods.Our results show that flowers are generally visited by P. phalaenoides females, but not over the whole distribution range of the plant. In some regions this fly species is less frequent or even absent and another species, Psycha grisescens, becomes the prevailing visitor. This variability is geographically structured and can be explained by climatic factors: the proportion of P. grisescens increases with higher annual precipitations and lower precipitations in the warmest trimester, two characteristics typical of the Mediterranean zone. Climate thus seems driving the specificity of this interaction, by potentially affecting the phenology of one or both interacting species, or even of volatile and heat production in the plant. This result therefore challenges the specificity of other presumably one-to-one interactions covering wide distribution ranges, and provides an example of the direct effect that the abiotic environment can have on the fate of plant-insect interactions.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The floral biology of Cordia multispicata (Boraginaceae) and Borreria alata (Rubiaceae) was studied in natural populations in a fragment of the Atlantic forest in Pernambuco, northeastern Brazil. Both species flower during almost the whole year. Cordia multispicata is a shrubby species with white, distylous and tubular flowers. Borreria alata is a herbaceous species. Its flowers are whitish, tubular and have a polymorphism in relation to the size of their style. Floral anthesis in both species begins at 6:00 a.m. Sugar concentration in the nectar was about 16% in C. multispicata and 30% in B. alata. Nine species of flies, mainly of the genus Palpada (Syrphidae), were observed visiting flowers of the two species. Seven of them were observed visiting and pollinating flowers of both C. multispicata and B. alata. Two species visited only flowers of C. multispicata, whereas no fly was exclusive to B. alata flowers. Both species have similar flower morphology, flowering time, habitats in the forest and establish populations very close to each other. These facts can favour the pollinators’ sharing and increase pollinator attraction.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We investigated if differences in morphological characters in two species of Metrodorea (Rutaceae) from Brazilian semideciduous forests correspond to some pollination divergence. M. nigra and M. stipularis are sympatric species, display a similar floral morphology, are protandrous, self-incompatible, their flower periods overlap, and both are pollinated by flies. M. nigra main pollinators are Pseudoptiloleps nigripoda (Muscidae) and Fannia sp. (Fanniidae); M. stipularis major pollinators are Phaenicia eximia (Calliphoridae), Palpada sp. and Ornidia obesa (Syrphidae). The distinct floral odor (disagreeable in M. nigra and sweet in M. stipularis) and color (brownish violet vs. pale yellow) determine the differences on type and number of floral visitors observed. Several species from semideciduous forests initially considered to be pollinated by diverse insects, present flies as main pollinators, stressing the importance of fly pollination in such habitats.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: The work was conducted to study phlebotomine fauna (Diptera: Psychodidae) and aspects of American cutaneous leishmaniasis transmission in a forested area where Leishmania (Leishmania) amazonensis occurs, situated in the municipality of Bela Vista, State of Mato Grosso do Sul, Brazil. METHODS: The captures were conducted with modified Disney traps, using hamster (Mesocricetus auratus) as bait, from May 2004 to January 2006. RESULTS: Ten species of phlebotomine sandflies were captured: Brumptomyia avellari, Brumptomyia brumpti, Bichromomyia flaviscutellata, Evandromyia bourrouli, Evandromyia lenti, Lutzomyia longipalpis, Psathyromyia campograndensis, Psathyromyia punctigeniculata, Psathyromyia shannoni and Sciopemyia sordellii. The two predominant species were Ev bourrouli (57.3%) and Bi flaviscutellata (41.4%), present at all sampling sites. Two of the 36 hamsters used as bait presented natural infection with Leishmania. The parasite was identified as Leishmania (Leishmania) amazonensis. CONCLUSIONS: Analysis of the results revealed the efficiency of Disney traps for capturing Bichromomyia flaviscutellata and the simultaneous presence of both vector and the Leishmania species transmitted by the same can be considered a predictive factor of the occurrence of leishmaniasis outbreaks for the human population that occupies the location.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pomegranate [Punica granatum (Punicaceae)] is characterized by having two types of flowers on the same tree: hermaphroditic bisexual flowers and functionally male flowers. This condition, defined as functional andromonoecy, can result in decreased yields resulting from the inability of male flowers to set fruit. Morphological and histological analyses of bisexual and male flowers were conducted using light and scanning electron microscopy (SEM) to characterize the different flower types observed in pomegranate plants and to better understand their developmental differences. Bisexual flowers had a discoid stigma covered with copious exudate, elongated stigmatic papillae, a single elongate style, and numerous stamens inserted on the inner wall of the calyx tube. Using fluorescence staining, high numbers of pollen tubes were observed growing through a central stylar canal. Ovules were numerous, elliptical, and anatropous. In contrast, male flowers had reduced female parts and exhibited shortened pistils of variable heights. Stigmatic papillae of male flowers had little exudate yet supported pollen germination. However, pollen tubes were rarely observed in styles. Ovules in male flowers were rudimentary and exhibited various stages of degeneration. Pollen from both types of flowers was of similar size, approximate to 20 mu m, and exhibited similar percent germination using in vitro germination assays. Pollen germination was strongly influenced by temperature. Maximal germination (greater than 74%) was obtained at 25 and 35 degrees C; pollen germination was significantly lower at 15 degrees C (58%) and 5 degrees C (10%).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The selection of candidate plus trees of desirable phenotypes from tropical forest trees and the rapid devastation of the natural environments in which these trees are found have created the need for a more detailed knowledge of the floral and reproductive biology of tropical tree species. In this article, the organogenic processes related to unisexual flower development in tropical mahogany, Swietenia macrophylla, are described. Mahogany inflorescences at different developmental stages were evaluated using scanning electron microscopy or optical microscopy of histological sections. The unisexual flowers of S. macrophylla are usually formed in a thyrse, in which the positions of the female and male flowers are not random. Differences between male and female flowers arise late during development. Both female and male flowers can only be structurally distinguished after stage 9, where ovule primordia development is arrested in male flowers and microspore development is aborted in female flower anthers. After this stage, male and female flowers can be distinguished by the naked eye as a result of differences in the dimensions of the gynoecium. The floral characteristics of S. macrophylla (distribution of male and female flowers within the inflorescence, and the relative number of male to female flowers) have practical implications for conservation strategies of this endangered species. (c) 2008 The Linnean Society of London, Botanical Journal of the Linnean Society, 2008, 156, 529-535.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A likely pathway to the sex pheromones of Bactrocera oleae (olive fruit-fly) is presented, based mainly on feeding experiments with deuterium labelled precursors.