922 resultados para FRUIT
Resumo:
Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.
Resumo:
Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.
Resumo:
In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.
Resumo:
The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.
Resumo:
The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.
Resumo:
Syrups with high sugar content and dehydrated fruits in its composition can be added to chocolate fillings to reduce the need of artificial flavor and dyes attributing a natural appeal to the product. Fruit bases were produced with lyophilized strawberry, passion fruit, and sliced orange peel. Rheological dynamic oscillatory tests were applied to determine the products stability and tendency of shelf life. Values of G´< G´´ were observed for strawberry and passion fruit flavor, whereas values of G´ > G´´ were found for orange flavor during the 90 days of storage. It was observed that shear stress values did not vary significantly suggesting product stability during the studied period. For all fillings, it was found a behavior similar to the fruit base indicating that it has great influence on the filling behavior and its stability. The use of a sugar matrix in fillings provided good shelf life for the fruit base, which could be kept under room temperature conditions for a period as long as one year. The good stability and storage conditions allow the use of fruit base for handmade products as well as for industrialized products.
Resumo:
As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.
Resumo:
Introduction. This protocol aims at ( a) evaluating the resistance to post-harvest diseases within different genotypes of bananas, and ( b) comparing different origins of bananas ( geographic origin, physiological stage, etc.) for their susceptibility to post-harvest diseases. The principle, key advantages, starting plant material, time required and expected results are presented. Materials and methods. Materials required and details of the twelve steps of the protocol ( fruit sampling and inoculum preparation, wound anthracnose resistance study, quiescent anthracnose resistance study and crown-rot resistance study) are described. Results. Typical symptoms of the different diseases are obtained after artificial inoculation.
Resumo:
Introduction. We present some protocols aiming at partially characterizing banana fruit quality through measurement of some key biochemical parameters. The principle, key advantages, starting plant material, time required and expected results are presented. Materials and methods. This part describes the required laboratory materials and the steps necessary for achieving four protocols making it possible to measure sugar, organic acids and free ACC contents, and in vitro ACC oxidase activity. Results. Standard results obtained by using the protocols described are presented in the figures.
Resumo:
Tamarindus indica has been used in folk medicine as an antidiabetic, a digestive aid, and a carminative, among other uses. Currently, there is no information in the toxicology literature concerning the safety of T. indica extract. We evaluated the clastogenic and/or genotoxic potential of fruit pulp extract of this plant in vivo in peripheral blood and liver cells of Wistar rats, using the comet assay, and in bone marrow cells of Swiss mice, using the micronucleus test. The extract was administered by gavage at doses of 1000, 1500 and 2000 mg/kg body weight. Peripheral blood and liver cells from Wistar rats were collected 24 h after treatment, for the comet assay. The micronucleus test was carried out in bone marrow cells from Swiss mice collected 24 h after treatment. The extract made with T. indica was devoid of clastogenic and genotoxic activities in the cells of the rodents, when administered orally at these three acute doses.
Resumo:
Mutualistic networks are crucial to the maintenance of ecosystem services. Unfortunately, what we know about seed dispersal networks is based only on bird-fruit interactions. Therefore, we aimed at filling part of this gap by investigating bat-fruit networks. It is known from population studies that: (i) some bat species depend more on fruits than others, and (ii) that some specialized frugivorous bats prefer particular plant genera. We tested whether those preferences affected the structure and robustness of the whole network and the functional roles of species. Nine bat-fruit datasets from the literature were analyzed and all networks showed lower complementary specialization (H(2)' = 0.3760.10, mean 6 SD) and similar nestedness (NODF = 0.5660.12) than pollination networks. All networks were modular (M=0.32 +/- 0.07), and had on average four cohesive subgroups (modules) of tightly connected bats and plants. The composition of those modules followed the genus-genus associations observed at population level (Artibeus-Ficus, Carollia-Piper, and Sturnira-Solanum), although a few of those plant genera were dispersed also by other bats. Bat-fruit networks showed high robustness to simulated cumulative removals of both bats (R = 0.55 +/- 0.10) and plants (R = 0.68 +/- 0.09). Primary frugivores interacted with a larger proportion of the plants available and also occupied more central positions; furthermore, their extinction caused larger changes in network structure. We conclude that bat-fruit networks are highly cohesive and robust mutualistic systems, in which redundancy is high within modules, although modules are complementary to each other. Dietary specialization seems to be an important structuring factor that affects the topology, the guild structure and functional roles in bat-fruit networks.
The gene transformer-2 of Anastrepha fruit flies (Diptera, Tephritidae) and its evolution in insects
Resumo:
Background: In the tephritids Ceratitis, Bactrocera and Anastrepha, the gene transformer provides the memory device for sex determination via its auto-regulation; only in females is functional Tra protein produced. To date, the isolation and characterisation of the gene transformer-2 in the tephritids has only been undertaken in Ceratitis, and it has been shown that its function is required for the female-specific splicing of doublesex and transformer pre-mRNA. It therefore participates in transformer auto-regulatory function. In this work, the characterisation of this gene in eleven tephritid species belonging to the less extensively analysed genus Anastrepha was undertaken in order to throw light on the evolution of transformer-2. Results: The gene transformer-2 produces a protein of 249 amino acids in both sexes, which shows the features of the SR protein family. No significant partially spliced mRNA isoform specific to the male germ line was detected, unlike in Drosophila. It is transcribed in both sexes during development and in adult life, in both the soma and germ line. The injection of Anastrepha transformer-2 dsRNA into Anastrepha embryos caused a change in the splicing pattern of the endogenous transformer and doublesex pre-mRNA of XX females from the female to the male mode. Consequently, these XX females were transformed into pseudomales. The comparison of the eleven Anastrepha Transformer-2 proteins among themselves, and with the Transformer-2 proteins of other insects, suggests the existence of negative selection acting at the protein level to maintain Transformer-2 structural features. Conclusions: These results indicate that transformer-2 is required for sex determination in Anastrepha through its participation in the female-specific splicing of transformer and doublesex pre-mRNAs. It is therefore needed for the auto-regulation of the gene transformer. Thus, the transformer/transfomer-2 > doublesex elements at the bottom of the cascade, and their relationships, probably represent the ancestral state ( which still exists in the Tephritidae, Calliphoridae and Muscidae lineages) of the extant cascade found in the Drosophilidae lineage ( in which tra is just another component of the sex determination gene cascade regulated by Sex-lethal). In the phylogenetic lineage that gave rise to the drosophilids, evolution co-opted for Sex-lethal, modified it, and converted it into the key gene controlling sex determination.