A remarkable new species of flesh-fly mimicking weevil (Coleoptera: Curculionidae: Conoderinae) from Southeastern Brazil

Timorus sarcophagoides, new species (type-locality: Brazil, Minas Gerais, Santana do Riacho - Serra do Cipo, 43 degrees 35'W 19 degrees 17'S, 1200-1300m ASL), is described and illustrated. The new species can be distinguished mainly from the other species of the genus by the sexual dimorphism of the male rostrum armed with a hooked tubercle at the base of the dorsal carina, while the tubercle is absent in the female and the corresponding region of the carina is only tumid. The new species has a striking pattern of coloration and behavior that mimics flesh-flies in the family Sarcophagidae. Observations on the natural history of the new species are reported and discussed.

Occurrences of flesh flies (Diptera: Sarcophagidae) on human cadavers in Switzerland, and their importance as forensic indicators.

From 1993 to 2008, criminal investigations were conducted in the western part of Switzerland with special attention to blowfly and flesh fly species in order to estimate the post-mortem interval when requested by the police authorities. Flesh flies were found in only 33 cases out of 160. Five species of the genus Sarcophaga were identified (S. africa, S. argyrostoma, S. caerulescens, S. similis and S. sp.). The main species found on corpses (larval stage) was S. argyrostoma. The thermal constant (K) calculated for this species in Switzerland is 380.6 ± 16.3 (mean ± S.D.) degree-days. With the exception of S. caerulescens, found three times in the larval stage on corpses, the three other species are of minor forensic importance. S. argyrostoma is found during summer and indoors. This species colonises dead bodies, usually the same day as blowfly species, and it could be used to estimate the post-mortem interval. Other species are discussed in the light of current knowledge on their biology and ecology. It is recommended that voucher material be deposited in a museum, allowing further studies by relevant specialists, thereby helping investigators and avoiding misidentifications.

Serine protease activities in Oxysarcodexia thornax (Walker) (Diptera: Sarcophagidae) first instar larva

We report for the first time the expression of multiple protease activities in the first instar larva (L1) of the flesh fly Oxysarcodexia thornax (Walker). Zymographic analysis of homogenates from freshly obtained L1 revealed a complex proteolytic profile ranging from 21.5 to 136 kDa. Although some activities were detected at pH 3.5 and 5.5, the optimum pH for most of the proteolytic activities was between pH 7.5 and 9.5. Seven of 10 proteases were completely inactivated by phenyl-methyl sulfonyl-fluoride, suggesting that main proteases expressed by L1 belong to serine proteases class. Complete inactivation of all enzymatic activities was obtained using N-p-Tosyl-L-phenylalanine chloromethyl ketone (100 µM), a specific inhibitor of chymotrypsin-like serine proteases.

Occurrence of Microcerella halli (Engel) (Diptera, Sarcophagidae) in snake carrion in southeastern Brazil

The occurrence of 27 second-instar larvae of the flesh fly Microcerella halli (Engel, 1931) (Diptera, Sarcophagidae) in a carcass of a snake usually called as Urutu, Bothrops alternatus (Duméril, Bibron & Duméril, 1854) (Serpentes, Viperidae, Crotalinae) is reported. The snake was kept in captivity in a snake farm in Morungaba, São Paulo state, Brazil. Descriptions of reptile carcass colonization by insects and general biological data of this flesh fly are scarce and this necrophagic behavior is described for the first time in literature.

Bionomy of two flies of sanitary and forensic importance: Peckia (Sarcodexia) lambens (Wiedemann) and Oxysarcodexia amorosa (Schiner) (Diptera, Sarcophagidae)

ABSTRACTThis study aims to elucidate the bionomy of Peckia(Sarcodexia) lambens and Oxysarcodexia amorosa to provide data for medical, veterinary and forensic entomology analyses. We analyzed larval stage duration (L1–L3), weight of the mature larvae (L3), pupal stage duration, L1–adult duration, adult emergence and viability of larvae and adults of both species. Larval viability of P. (S.) lambens was 82% and the mean duration of the larval stage was 3.51 ± 0.99 days. The mature larvae had a mean weight of 33.67 ± 7.13 mg. The mean duration of the pupal stage was 8.26 ± 0.93 days and the mean duration of the L1–adult was 11.53 ± 1.22 days. Mean lifespan for females and males was 39.33 ± 1.52 and 57.33 ± 4.72 days, respectively. Larval viability of O. amorosa was 76% and mean duration of larval stage was 3.51 ± 0.64 days. Mature larvae had a mean weight of 28.28 ± 3.38 mg. Mean duration of the pupal stage was 10.14 ± 0.63 days and mean duration of the L1–adult was 13.60 ± 0.69 days. Mean lifespan for females and males was 83.66 ± 15.94 and 84.00 ± 19.97 days, respectively. Oxysarcodexia amorosa showed a L1–adult stage longer than P. (S.) lambens; however both species showed low viability. O. amorosa laid more larvae than P. (S.) lambens, this fact may occur because O. amorosa had longer life duration.

Occurrence of Microcerella halli (Engel) (Diptera, Sarcophagidae) in snake carrion in southeastern Brazil

Occurrence of Microcerella halli (Engel) (Diptera, Sarcophagidae) in snake carrion in southeastern Brazil. The occurrence of 27 second-instar larvae of the flesh fly Microcerella halli (Engel, 1931) (Diptera, Sarcophagidae) in a carcass of a snake usually called as Urutu, Bothrops alternatus (Dumeril, Bibron & Dumeril, 1854) (Serpentes, Viperidae, Crotalinae) is reported. The snake was kept in captivity in a snake farm in Morungaba, São Paulo state, Brazil. Descriptions of reptile carcass colonization by insects and general biological data of this flesh fly are scarce and this necrophagic behavior is described for the first time in literature.

Sazonalidade, sinantropia e preferência por iscas de dípteros necrófagos da região de Rio Claro, SP

Pós-graduação em Ciências Biológicas (Zoologia) - IBRC

The 3D structure and function of digestive cathepsin L-like proteinases of Tenebrio molitor larval midgut

Cathepsin L-like proteinases (CAL) are major digestive proteinases in the beetle Tenebrio molitor. Procathepsin Ls 2 (pCAL2) and 3 (pCAL3) were expressed as recombinant proteins in Escherichia coil, purified and activated under acidic conditions. Immunoblot analyses of different T. molitor larval tissues demonstrated that a polyclonal antibody to pCAL3 recognized pCAL3 and cathepsin L 3 (CAD) only in the anterior two-thirds of midgut tissue and midgut luminal contents of T. molitor larvae. Furthermore, immunocytolocalization data indicated that pCAL3 occurs in secretory vesicles and microvilli in anterior midgut Therefore CAL3, like cathepsin L 2 (CAL2), is a digestive enzyme secreted by T. molitor anterior midgut CAD hydrolyses Z-FR-MCA and Z-RR-MCA (typical cathepsin substrates), whereas CAL2 hydrolyses only Z-FR-MCA. Active site mutants (pCAL2C25S and pCAL3C265) were constructed by replacing the catalytic cysteine with serine to prevent autocatalytic processing. Recombinant pCAL2 and pCAL3 mutants (pCAL2C25S and pCAL3C26S) were prepared, crystallized and their 3D structures determined at 1.85 and 2.1 angstrom, respectively. While the overall structure of these enzymes is similar to other members of the papain superfamily, structural differences in the S2 subsite explain their substrate specificities. The data also supported models for CAL trafficking to lysosomes and to secretory vesicles to be discharged into midgut contents. (C) 2012 Elsevier Ltd. All rights reserved.

Developmental Rate Of Immatures Of Two Fly Species Of Forensic Importance: Sarcophaga (liopygia) Ruficornis And Microcerella Halli (diptera: Sarcophagidae).

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae) fruit-fly species and their hybrids

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

Sand fly captures with Disney traps in area of occurrence of Leishmania (Leishmania) amazonensis in the state of Mato Grosso do Sul, mid-western Brazil

INTRODUCTION: The work was conducted to study phlebotomine fauna (Diptera: Psychodidae) and aspects of American cutaneous leishmaniasis transmission in a forested area where Leishmania (Leishmania) amazonensis occurs, situated in the municipality of Bela Vista, State of Mato Grosso do Sul, Brazil. METHODS: The captures were conducted with modified Disney traps, using hamster (Mesocricetus auratus) as bait, from May 2004 to January 2006. RESULTS: Ten species of phlebotomine sandflies were captured: Brumptomyia avellari, Brumptomyia brumpti, Bichromomyia flaviscutellata, Evandromyia bourrouli, Evandromyia lenti, Lutzomyia longipalpis, Psathyromyia campograndensis, Psathyromyia punctigeniculata, Psathyromyia shannoni and Sciopemyia sordellii. The two predominant species were Ev bourrouli (57.3%) and Bi flaviscutellata (41.4%), present at all sampling sites. Two of the 36 hamsters used as bait presented natural infection with Leishmania. The parasite was identified as Leishmania (Leishmania) amazonensis. CONCLUSIONS: Analysis of the results revealed the efficiency of Disney traps for capturing Bichromomyia flaviscutellata and the simultaneous presence of both vector and the Leishmania species transmitted by the same can be considered a predictive factor of the occurrence of leishmaniasis outbreaks for the human population that occupies the location.

OFFSPRING IN RESPONSE TO PARENTAL FEMALE DENSITIES IN THE FRUIT FLY PARASITOID DIACHASMIMORPHA LONGICAUDATA (HYMENOPTERA: BRACONIDAE: OPIINAE)

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.

Biogenesis of sex pheromones in the female olive fruit-fly

A likely pathway to the sex pheromones of Bactrocera oleae (olive fruit-fly) is presented, based mainly on feeding experiments with deuterium labelled precursors.