849 resultados para Exceptional events


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The integration of the Smart Grid concept into the electric grid brings to the need for an active participation of small and medium players. This active participation can be achieved using decentralized decisions, in which the end consumer can manage loads regarding the Smart Grid needs. The management of loads must handle the users’ preferences, wills and needs. However, the users’ preferences, wills and needs can suffer changes when faced with exceptional events. This paper proposes the integration of exceptional events into the SCADA House Intelligent Management (SHIM) system developed by the authors, to handle machine learning issues in the domestic consumption context. An illustrative application and learning case study is provided in this paper.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

The EPA promulgated the Exceptional Events Rule codifying guidance regarding exclusion of monitoring data from compliance decisions due to uncontrollable natural or exceptional events. This capstone examines documentation systems utilized by agencies requesting data be excluded from compliance decisions due to exceptional events. A screening tool is developed to determine whether an event would meet exceptional event criteria. New data sources are available to enhance analysis but evaluation shows many are unusable in their current form. The EPA and States must collaborate to develop consistent evaluation methodologies documenting exceptional events to improve the efficiency and effectiveness of the new rule. To utilize newer sophisticated data, consistent, user-friendly translation systems must be developed.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Cette thèse jette un œil sceptique sur plusieurs théories courantes de l’état d’urgence. La plupart de ces théories de l’état d’urgence présupposent que la notion d'une « urgence » est claire, conceptuellement et pratiquement. J'argue que ceci n'est pas le cas et que cette certitude mal placée produit des problèmes pratiques et conceptuels avec ses théories. De plus, cette thèse démontre que cette certitude mal placée dans la clarté du concept de l'urgence mène les autorités gouvernementales à agir arbitrairement plutôt que selon des principes libéraux et démocratiques pendant des états d’urgence. Contre cette certitude mal placée et contre plusieurs théories contemporaines influentes des états d'urgence, j'offre une théorie rigoureuse et analytique du concept de l’« urgence. » Une fois que le concept de l'urgence est défini, et que cette conception est défendue, la thèse démontre les diverses manières dont les malentendus du concept, mènent aux utilisations arbitraires (de la puissance monopole de l'état) en situation d’urgence. En considérant les états d’urgences, comme événements rares, la thèse évite la tentation de les considérer comme événements exceptionnels capable de fragmenter l'ordre politique établi (comme d’autres théories le font). La thèse argue que les mesures prises par le gouvernent pendant l’état d’urgence devraient être compatibles plus généralement avec les valeurs démocratiques et libérales. En rejetant l'idée que les états d'urgence sont des événements exceptionnels, la thèse crée un espace conceptuel dans lequel des propositions plus constructives concernant la gestion des états d'urgence peuvent être entendues. De plus, en analysant les diverses manières dont les autorités gouvernementales utilisent leur forces de façon arbitraire pendant les états d’urgence, la thèse argue clairement pour la supervision institutionnelle accrue en ce qui concerne les procédures d’urgence et leur déploiement pendant des états d'urgence. En conclusion, la thèse argue que les démocraties libérales n'ont pas besoin de craindre les états d’urgences tandis que les démocraties libérales ont déjà les ressources requise pour administrer les états d’urgence. Contrairement à ce que d’autres théories l’état d'urgence recommandent, les démocraties libérales ont déjà les ressources institutionnelles et conceptuelles pour administrer les états d’urgences.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

O tempo sempre desempenhou relevante função de estabilização das relações jurídicas e decantação da memória individual, fazendo com que a divulgação de fatos desagradáveis ou sacrificantes aos direitos da personalidade tivessem, salvo em eventos excepcionais de ordem histórica, por força de um processo natural de erosão da sua relevância e atualidade, como destino o esquecimento. Esse mecanismo natural, capaz de assegurar o exercício de novas escolhas e o livre desenvolvimento da personalidade, restou substancialmente mitigado pelo surgimento da sociedade de informação, com a expansão dos veículos de comunicação de massa e a rede mundial de computadores, com sua memória infalível, a permitir a divulgação e o amplo acesso, com idêntica facilidade, a informações atuais e do passado. Releva, portanto, discutir a existência de um direito ao esquecimento, como forma de estabelecer, salvo em situações de inequívoco interesse público, uma limitação temporal para a manutenção e para a divulgação de fatos passados e referências pessoais, fora de um contexto de atualidade, capazes de macular a honra, o bom nome, a privacidade e a integridade psicológica das pessoas, bem como a possibilidade de que a ofensa injustificada a um direito da personalidade protegido pelo esquecimento, praticada com abuso do direito de informar, seja considerada ilícita.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Water systems in the Sultanate of Oman are inevitably exposed to varied threats and hazards due to both natural and man-made hazards. Natural disasters, especially tropical cyclone Gonu in 2007, cause immense damage to water supply systems in Oman. At the same time water loss from leaks is a major operational problem. This research developed an integrated approach to identify and rank the risks to the water sources, transmission pipelines and distribution networks in Oman and suggests appropriate mitigation measures. The system resilience was evaluated and an emergency response plan for the water supplies developed. The methodology involved mining the data held by the water supply utility for risk and resilience determination and operational data to support calculations of non-revenue water. Risk factors were identified, ranked and scored at a stakeholder workshop and the operational information required was principally gathered from interviews. Finally, an emergency response plan was developed by evaluating the risk and resilience factors. The risk analysis and assessment used a Coarse Risk Analysis (CRA) approach and risk scores were generated using a simple risk matrix based on WHO recommendations. The likelihoods and consequences of a wide range of hazardous events were identified through a key workshop and subsequent questionnaires. The thesis proposes a method of translating the detailed risk evaluations into resilience scores through a methodology used in transportation networks. A water audit indicated that the percentage of NRW in Oman is greater than 35% which is similar to other Gulf countries but high internationally. The principal strategy for managing NRW used in the research was the AWWA water audit method which includes free to use software and was found to be easy to apply in Oman. The research showed that risks to the main desalination processes can be controlled but the risk due to feed water quality might remain high even after implementing mitigation measures because the intake is close to an oil port with a significant risk of oil contamination and algal blooms. The most severe risks to transmission mains were found to be associated with pipe rather than pump failure. The systems in Oman were found to be moderately resilient, the resilience of desalination plants reasonably high but the transmission mains and pumping stations are very vulnerable. The integrated strategy developed in this study has a wide applicability, particularly in the Gulf area, which may have risks from exceptional events and will be experiencing NRW. Other developing countries may also experience such risks but with different magnitudes and the risk evaluation tables could provide a useful format for further work.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

As people spend a third of their lives at work and, in most cases, indoors, the work environment assumes crucial importance. The continuous and dynamic interaction between people and the working environment surrounding them produces physiological and psychological effects on operators. Recognizing the substantial impact of comfort and well-being on employee satisfaction and job performance, the literature underscores the need for industries to implement indoor environment control strategies to ensure long-term success and profitability. However, managing physical risks (i.e., ergonomic and microclimate) in industrial environments is often constrained by production and energy requirements. In the food processing industry, for example, the safety of perishable products dictates storage temperatures that do not allow for operator comfort. Conversely, warehouses dedicated to non-perishable products often lack cooling systems to limit energy expenditure, reaching high temperatures in the summer period. Moreover, exceptional events, like the COVID-19 pandemic, introduce new constraints, with recommendations impacting thermal stress and respiratory health. Furthermore, the thesis highlights how workers' variables, particularly the aging process, reduce tolerance to environmental stresses. Consequently, prolonged exposure to environmental stress conditions at work results in cardiovascular disease and musculoskeletal disorders. In response to the global trend of an aging workforce, the thesis bridges a literature gap by proposing methods and models that integrate the age factor into comfort assessment. It aims to present technical and technological solutions to mitigate microclimate risks in industrial environments, ultimately seeking innovative ways to enhance the aging workforce's comfort, performance, experience, and skills. The research outlines a logical-conceptual scheme with three main areas of focus: analyzing factors influencing the work environment, recognizing constraints to worker comfort, and designing solutions. The results significantly contribute to science by laying the foundation for new research in worker health and safety in an ageing working population's extremely current industrial context.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This study presents geo-scientific evidence for Holocene tsunami impact along the shores of the Eastern Ionian Sea. Cefalonia Island, the Gulf of Kyparissia and the Gialova Lagoon were subject of detailed geo-scientific investigations. It is well known that the coasts of the eastern Mediterranean were hit by the destructive influence of tsunamis in the past. The seismically highly active Hellenic Trench is considered as the most significant tsunami source in the Eastern Ionian Sea. This study focuses on the reconstruction and detection of sedimentary signatures of palaeotsunami events and their influence on the Holocene palaeogeographical evolution. The results of fine grained near coast geo-archives are discussed and interpreted in detail to differentiate between tsunami, storm and sea level highstands as sedimentation processes.rnA multi-method approach was applied using geomorphological, sedimentological, geochemical, geophysical and microfaunal analyses to detect Holocene tsunamigenic impact. Chronological data were based on radiocarbondatings and archaeological age estimations to reconstruct local geo-chronostratigraphies and to correlate them on supra-regional scales.rnDistinct sedimentary signatures of 5 generations of tsunami impact were found along the coasts of Cefalonia in the Livadi coastal plain. The results show that the overall coastal evolution was influenced by tsunamigenic impact that occured around 5700 cal BC (I), 4250 cal BC (II), at the beginning of the 2nd millennium cal BC (III), in the 1st millennium cal BC (IV) and posterior to 780 cal AD (V). Sea level reconstructions and the palaeogeographical evolution show that the local Holocene sea level has never been higher than at present.rnAt the former Mouria Lagoon along the Gulf of Kyparissia almost four allochtonous layers of tsunamigenic origin were identified. The stratigraphical record and palaeogeographical reconstructions show that major environmental coastal changes were linked to these extreme events. At the southern end of the Agoulenitsa Lagoon at modern Kato Samikon high-energy traces were found more than 2 km inland and upt ot 9 m above present sea level. The geo-chronological framework deciphered tsunami landfall for the 5th millennium cal BC (I), mid to late 2nd mill. BC (II), Roman times (1st cent. BC to early 4th cent. AD) (III) and most possible one of the historically well-known 365 AD or 521/551 AD tsunamis (IV).rnCoarse-grained allochthonous sediments of marine origin were found intersecting muddy deposits of the quisecent sediments of the Gialova Lagoon on the southwestern Peloponnese. Radiocarbondatings suggest 6 generations of major tsunami impact. Tsunami generations were dated to around 3300 cal BC (I), around the end of 4th and the beginning of 3rd millennium BC (II), after around 1100 cal BC (III), after the 4th to 2nd cent. BC (IV), between the 8th and early 15th cent. AD (V) and between the mid 14th to beginning of 15th cent. AD (VI). Palaeogeographical and morphological characteristics in the environs of the Gialova Lagoon were controlled by high-energy influence.rnSedimentary findings in all study areas are in good accordance to traces of tsunami events found all over the Ionian Sea. The correlation of geo-chronological data fits very well to coastal Akarnania, the western Peloponnese and finding along the coasts of southern Italy and the Aegean. Supra-regional influence of tsunamigenic impact significant for the investigated sites. The palaeogeographical evolution and palaeo-geomorphological setting of the each study area was strongly affected by tsunamigenic impact.rnThe selected geo-archives represent extraordinary sediment traps for the reconstruction of Holocene coastal evolution. Our result therefore give new insight to the exceptional high tsunami risk in the eastern Mediterranean and emphasize the underestimation of the overall tsunami hazard.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Happy emotional states have not been extensively explored in functional magnetic resonance imaging studies using autobiographic recall paradigms. We investigated the brain circuitry engaged during induction of happiness by standardized script-driven autobiographical recall in 11 healthy subjects (6 males), aged 32.4 ± 7.2 years, without physical or psychiatric disorders, selected according to their ability to vividly recall personal experiences. Blood oxygen level-dependent (BOLD) changes were recorded during auditory presentation of personal scripts of happiness, neutral content and negative emotional content (irritability). The same uniform structure was used for the cueing narratives of both emotionally salient and neutral conditions, in order to decrease the variability of findings. In the happiness relative to the neutral condition, there was an increased BOLD signal in the left dorsal prefrontal cortex and anterior insula, thalamus bilaterally, left hypothalamus, left anterior cingulate gyrus, and midportions of the left middle temporal gyrus (P < 0.05, corrected for multiple comparisons). Relative to the irritability condition, the happiness condition showed increased activity in the left insula, thalamus and hypothalamus, and in anterior and midportions of the inferior and middle temporal gyri bilaterally (P < 0.05, corrected), varying in size between 13 and 64 voxels. Findings of happiness-related increased activity in prefrontal and subcortical regions extend the results of previous functional imaging studies of autobiographical recall. The BOLD signal changes identified reflect general aspects of emotional processing, emotional control, and the processing of sensory and bodily signals associated with internally generated feelings of happiness. These results reinforce the notion that happiness induction engages a wide network of brain regions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We estimated the sensitivity, i.e., the proportion of all cases of adverse events following immunization (AEFIs) reported to the Brazilian passive surveillance for adverse events following immunization (PSAEFI) with the diphtheria-tetanus-whole-cell pertussis-Haemophilus influenzae type b (DTwP-Hib) vaccine, as well as investigating factors associated with AEFIs reporting. During 2003–2004, 8303 AEFIs associated with DTwP-Hib were reported; hypotonic-hyporesponsive episodes (HHEs), fever and convulsions being the most common. Cure without sequel was achieved in 98.4 per cent of the cases. The mean sensitivity of the PSAEFI was 22.3 per cent and 31.6 per cent, respectively, for HHE and convulsions, varying widely among states. Reporting rates correlated positively with the Human Development Index and coverage of adequate prenatal care, correlating negatively with infant mortality rates. Quality of life indicators and the degree of organization of health services are associated with greater PSAEFI sensitivity. In addition to consistently describing the principal AEFIs, PSAEFI showed the DTwP/Hib vaccine to be safe and allayed public fears related to its use

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: To determine whether information from genetic risk variants for diabetes is associated with cardiovascular events incidence. Methods: From the about 30 known genes associated with diabetes, we genotyped single-nucleotide polymorphisms at the 10 loci most associated with type-2 diabetes in 425 subjects from the MASS-II Study, a randomized study in patients with multi-vessel coronary artery disease. The combined genetic information was evaluated by number of risk alleles for diabetes. Performance of genetic models relative to major cardiovascular events incidence was analyzed through Kaplan-Meier curve comparison and Cox Hazard Models and the discriminatory ability of models was assessed for cardiovascular events by calculating the area under the ROC curve. Results: Genetic information was able to predict 5-year incidence of major cardiovascular events and overall-mortality in non-diabetic individuals, even after adjustment for potential confounders including fasting glycemia. Non-diabetic individuals with high genetic risk had a similar incidence of events then diabetic individuals (cumulative hazard of 33.0 versus 35.1% of diabetic subjects). The addition of combined genetic information to clinical predictors significantly improved the AUC for cardiovascular events incidence (AUC = 0.641 versus 0.610). Conclusions: Combined information of genetic variants for diabetes risk is associated to major cardiovascular events incidence, including overall mortality, in non-diabetic individuals with coronary artery disease.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Community and clinical data have suggested there is an association between trauma exposure and suicidal behavior (i.e., suicide ideation, plans and attempts). However, few studies have assessed which traumas are uniquely predictive of: the first onset of suicidal behavior, the progression from suicide ideation to plans and attempts, or the persistence of each form of suicidal behavior over time. Moreover, few data are available on such associations in developing countries. The current study addresses each of these issues. Methodology/Principal Findings: Data on trauma exposure and subsequent first onset of suicidal behavior were collected via structured interviews conducted in the households of 102,245 (age 18+) respondents from 21 countries participating in the WHO World Mental Health Surveys. Bivariate and multivariate survival models tested the relationship between the type and number of traumatic events and subsequent suicidal behavior. A range of traumatic events are associated with suicidal behavior, with sexual and interpersonal violence consistently showing the strongest effects. There is a dose-response relationship between the number of traumatic events and suicide ideation/attempt; however, there is decay in the strength of the association with more events. Although a range of traumatic events are associated with the onset of suicide ideation, fewer events predict which people with suicide ideation progress to suicide plan and attempt, or the persistence of suicidal behavior over time. Associations generally are consistent across high-, middle-, and low-income countries. Conclusions/Significance: This study provides more detailed information than previously available on the relationship between traumatic events and suicidal behavior and indicates that this association is fairly consistent across developed and developing countries. These data reinforce the importance of psychological trauma as a major public health problem, and highlight the significance of screening for the presence and accumulation of traumatic exposures as a risk factor for suicide ideation and attempt.