Time series morphological analysis applied to biomedical signals events detection

Dissertation submitted in the fufillment of the requirements for the Degree of Master in Biomedical Engineering

Statistical model applied to NetFlow for network intrusion detection

The computers and network services became presence guaranteed in several places. These characteristics resulted in the growth of illicit events and therefore the computers and networks security has become an essential point in any computing environment. Many methodologies were created to identify these events; however, with increasing of users and services on the Internet, many difficulties are found in trying to monitor a large network environment. This paper proposes a methodology for events detection in large-scale networks. The proposal approaches the anomaly detection using the NetFlow protocol, statistical methods and monitoring the environment in a best time for the application. © 2010 Springer-Verlag Berlin Heidelberg.

A method to determine the impact of visual function on lesion detection performance

There are few professions in which visual acuity is as important as it is to radiologists. The diagnostic decision making process is composed of a number of events (detection or observation, interpretation and reporting), where the detection phase is subject to a number of physical and psychological phenomena that are critical to the process. Visual acuity is one phenomenon that has often been overlooked, and there is very little research assessing the impact of reduced visual acuity on diagnostic performance. The aim of this study was to investigate the impact of reduced visual acuity on an observer’s ability to detect simulated nodules in an anthropomorphic chest phantom.

Mitotic crossing-over induced by two commercial herbicides in diploid strains of the fungus Aspergillus nidulans

Some herbicides are suspected of promoting teratogenic, carcinogenic and mutagenic events. Detection of induced mitotic crossing-over has proven to be an indirect way of testing the carcinogenic properties of suspicious substances, because mitotic crossing-over is involved in the multistep process of carcinogenesis. We examined mitotic crossing-over induced by two commercial herbicides (diuron and trifluralin) in diploid strains of Aspergillus nidulans based on the homozygotization index. Low doses (2.5 mu g/mL) of diuron were sufficient to increase the mean homozygotization index in 2.1 and 11.3 times for UT448//UT196 and Dp II-I//UT196, respectively, whereas the same dose of trifluralin increased this mean only 1.2 (UT448//UT196) and 3.5 (Dp II-I//UT196) times, respectively. The lower homozygotization index value found for trifluralin could be due to its interference with mitotic crossing-over in eukaryotic cells. We concluded that the diploid Dp II-I//UT196 of A. nidulans is more sensitive to organic compounds than UT448//UT196; these compounds cause recombinational events at a greater frequency in the latter diploid. This system holds promise as an initial test for carcino-genicity of organic compounds, including herbicides.

Algorithms for information extraction and signal annotation on long-term biosignals using clustering techniques

Dissertação para obtenção do Grau de Mestre em Engenharia Biomédica

Sistema de deteção de eventos adversos baseado num data warehouse

RESUMO - A Segurança do Doente tem assumido uma relevância crescente nas organizações de saúde, resultado da divulgação de diversos estudos que revelaram a magnitude deste problema e simultaneamente, de uma maior pressão por parte da opinião pública e da comunicação social. Este estudo pretende desenvolver e avaliar a performance de um sistema eletrónico de deteção de eventos adversos, baseado num Data Warehouse, por comparação com os resultados obtidos pela metodologia tradicional de revisão dos registos clínicos. O objetivo principal do trabalho consistiu em identificar um conjunto de triggers / indicadores de alerta que permitam detetar potenciais eventos adversos mais comuns. O sistema desenvolvido apresentou um Valor Preditivo Positivo de 18.2%, uma sensibilidade de 65.1% e uma especificidade de 68.6%, sendo constituído por nove indicadores baseados em informação clínica e 445 códigos do ICD-9-CM, relativos a diagnósticos e procedimentos. Apesar de terem algumas limitações, os sistemas eletrónicos de deteção de eventos adversos apresentam inúmeras potencialidades, nomeadamente a utilização em tempo real e em complemento a metodologias já existentes. Considerando a importância da problemática em análise e a necessidade de aprofundar os resultados obtidos neste trabalho de projeto, seria relevante a sua extensão a um universo mais alargado de instituições hospitalares, estando a sua replicabilidade facilitada, uma vez que o Data Warehouse tem por base um conjunto de aplicações disseminadas a nível nacional. O desenvolvimento e a consolidação dos sistemas eletrónicos de deteção de eventos adversos constitui inegavelmente uma área de futuro, com reflexos ao nível da melhoria da informação existente nas organizações e que contribuirá decisivamente para a melhoria dos cuidados de saúde prestados aos doentes.

Développement et validation d'un instrument non-invasifde caractérisation du comportement musculaire respiratoire

Réalisé en cotutelle avec l'Université Joseph Fourier École Doctorale Ingénierie pour la Santé,la Cognition et l'Environnement (France)

Implementation of intelligent data acquisition system for ITER fast controllers using RIO devices.

A basic requirement of the data acquisition systems used in long pulse fusion experiments is the real time physical events detection in signals. Developing such applications is usually a complex task, so it is necessary to develop a set of hardware and software tools that simplify their implementation. This type of applications can be implemented in ITER using fast controllers. ITER is standardizing the architectures to be used for fast controller implementation. Until now the standards chosen are PXIe architectures (based on PCIe) for the hardware and EPICS middleware for the software. This work presents the methodology for implementing data acquisition and pre-processing using FPGA-based DAQ cards and how to integrate these in fast controllers using EPICS.

Spring snowmelt and midwinter thaw and refreeze north of 60°N based on Seawinds QuikScat 2000-2009

The scatterometer SeaWinds on QuikSCAT provided regular measurements at Ku-band from 1999 to 2009. Although it was designed for ocean applications, it has been frequently used for the assessment of seasonal snowmelt patterns aside from other terrestrial applications such as ice cap monitoring, phenology and urban mapping. This paper discusses general data characteristics of SeaWinds and reviews relevant change detection algorithms. Depending on the complexity of the method, parameters such as long-term noise and multiple event analyses were incorporated. Temporal averaging is a commonly accepted preprocessing step with consideration of diurnal, multi-day or seasonal averages.

Projeto de aplicação de cuidados anestésicos na monitorização de situações clínicas de hipoperfusão orgânica

Apesar dos avanços na sua abordagem terapêutica, a hemorragia severa continua a ser a principal causa de morbilidade e mortalidade em animais vítimas de trauma ou sujeitos a intervenção cirúrgica. O aparecimento de lesões decorrentes, ou da morte consequente, deve-se ao deficit de volume de fluidos intravasculares e subsequente desenvolvimento do estado hipovolémico. Em termos fisiológicos, a consequência mais devastadora desta condição é a diminuição, absoluta ou relativa, da pré-carga cardíaca, resultando num baixo débito cardíaco, perfusão tecidular inadequada e diminuição do aporte de oxigénio aos tecidos, o qual compromete, inequivocamente, a função celular. O controlo da hipovolémia passa pela resolução da hemorragia e pela correção do deficit de volume intravascular causado e envolve, obrigatoriamente, o recurso à administração de fluidos intravenosos. A escolha do tipo de fluido mais adequado para a terapia intravenosa, em cada ocorrência, é uma tarefa que exige reflexão e ponderação. A seleção dos fluidos apropriados é da responsabilidade do médico veterinário, sendo, no entanto, fundamental que o enfermeiro veterinário detenha conhecimentos básicos sobre as diferenças entre os fluidos disponíveis para a fluidoterapia. O objetivo deste projeto é determinar qual o tipo de fluido mais adequado para ajudar a preservar a integridade e funcionalidade hepática, em situações de hipoperfusão, e assim ajudar a padronizar a sua escolha no momento da decisão pela fluidoterapia. Para atingir este objetivo recorreu-se ao modelo suíno, a fim de recrear a situação de hipoperfusão e posteriormente avaliar os efeitos de dois fluidos diferentes administrados na reposição volémica, o lactato de Ringer e hidroxietilamido 130/0,4. Os animais foram sujeitos a uma hemorragia controlada, após a qual foi reposta a volémia com os respetivos fluidos. Após esta reposição volémica os animais foram eutanaziados e foram obtidas amostras de vários órgãos, incluindo fígado, objeto do presente estudo, alvo de diversas técnicas histopatológicas, nomeadamente o estudo histopatológico de rotina, através de hematoxilina e eosina, e diversos métodos para deteção de eventos apoptóticos, incluindo citocromo c, TUNEL e M30.Após a avaliação exaustiva dos resultados obtidos através das técnicas realizadas, foi possível concluir que o lactato de Ringer confere uma maior proteção contra a lesão de reperfusão, quando comparado com o hidroxietilamido 130/0,4.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparison of AutoSetä and polysomnography for the detection of apnea-hypopnea events

The use of the flow vs time relationship obtained with the nasal prongs of the AutoSetä (AS) system (diagnosis mode) has been proposed to detect apneas and hypopneas in patients with reasonable nasal patency. Our aim was to compare the accuracy of AS to that of a computerized polysomnographic (PSG) system. The study was conducted on 56 individuals (45 men) with clinical characteristics of obstructive sleep apnea (OSA). Their mean (± SD) age was 44.6 ± 12 years and their body mass index was 31.3 ± 7 kg/m2. Data were submitted to parametric analysis to determine the agreement between methods and the intraclass correlation coefficient was calculated. The Student t-test and Bland and Altman plots were also used. Twelve patients had an apnea-hypopnea index (AHI) <10 in bed and 20 had values >40. The mean (± SD) AHI PSG index of 37.6 (28.8) was significantly lower (P = 0.0003) than AHI AS (41.8 (25.3)), but there was a high intraclass correlation coefficient (0.93), with 0.016 variance. For a threshold of AHI of 20, AS showed 73.0% accuracy, 97% sensitivity and 60% specificity, with positive and negative predictive values of 78% and 93%, respectively. Sensitivity, specificity and negative predictive values increased in parallel to the increase in AHI threshold for detecting OSA. However, when the differences of AHI PSG-AS were plotted against their means, the limits of agreement between the methods (95% of the differences) were +13 and -22, showing the discrepancy between the AHI values obtained with PSG and AS. Finally, cubic regression analysis was used to better predict the result of AHI PSG as a function of the method proposed, i.e., AHI AS. We conclude that, despite these differences, AHI measured by AutoSetä can be useful for the assessment of patients with high pre-test clinical probability of OSA, for whom standard PSG is not possible as an initial step in diagnosis.

Detection of genetically modified maize events in Brazilian maize-derived food products

The Brazilian government has approved many transgenic maize lines for commercialization and has established a threshold of 1% for food labeling, which underscores need for monitoring programs. Thirty four samples including flours and different types of nacho chips were analyzed by conventional and real-time PCR in 2011 and 2012. The events MON810, Bt11, and TC1507 were detected in most of the samples, and NK603 was present only in the samples analyzed in 2012. The authorized lines GA21, T25, and the unauthorized Bt176 were not detected. All positive samples in the qualitative tests collected in 2011 showed a transgenic content higher than 1%, and none of them was correctly labeled. Regarding the samples collected in 2012, all positive samples were quantified higher than the threshold, and 47.0% were not correctly labeled. The overall results indicated that the major genetically modified organisms detected were MON810, TC1507, Bt11, and NK603 events. Some industries that had failed to label their products in 2011 started labeling them in 2012, demonstrating compliance with the current legislation observing the consumer rights. Although these results are encouraging, it has been clearly demonstrated the need for continuous monitoring programs to ensure consumers that food products are labeled properly.

A multi-level analytical approach for detection and visualization of intracellular NO production and nitrosation events using diaminofluoresceins

Diaminofluoresceins are widely used probes for detection and intracellular localization of NO formation in cultured/isolated cells and intact tissues. The fluorinated derivative, 4-amino-5-methylamino-2′,7′-difluorofluorescein (DAF-FM), has gained increasing popularity in recent years due to its improved NO-sensitivity, pH-stability, and resistance to photo-bleaching compared to the first-generation compound, DAF-2. Detection of NO production by either reagent relies on conversion of the parent compound into a fluorescent triazole, DAF-FM-T and DAF-2-T, respectively. While this reaction is specific for NO and/or reactive nitrosating species, it is also affected by the presence of oxidants/antioxidants. Moreover, the reaction with other molecules can lead to the formation of fluorescent products other than the expected triazole. Thus additional controls and structural confirmation of the reaction products are essential. Using human red blood cells as an exemplary cellular system we here describe robust protocols for the analysis of intracellular DAF-FM-T formation using an array of fluorescence-based methods (laser-scanning fluorescence microscopy, flow cytometry and fluorimetry) and analytical separation techniques (reversed-phase HPLC and LC-MS/MS). When used in combination, these assays afford unequivocal identification of the fluorescent signal as being derived from NO and are applicable to most other cellular systems without or with only minor modifications.

Sensitive and selective detection of free FXIII activation peptide: a potential marker of acute thrombotic events

Coagulation factor XIII (FXIII) stabilizes fibrin fibers and is therefore a major player in the maintenance of hemostasis. FXIII is activated by thrombin resulting in cleavage and release of the FXIII activation peptide (AP-FXIII). The objective of this study was to characterize the released AP-FXIII and determine specific features that may be used for its specific detection. We analyzed the structure of bound AP-FXIII within the FXIII A-subunit and interactions of AP-FXIII by hydrogen bonds with both FXIII A-subunit monomers. We optimized our previously developed AP-FXIII ELISA by using 2 monoclonal antibodies. We determined high binding affinities between the antibodies and free AP-FXIII and demonstrated specific binding by epitope mapping analyses with surface plasmon resonance and enzyme-linked immunosorbent assay. Because the structure of free AP-FXIII had been characterized so far by molecular modeling only, we performed structural analysis by nuclear magnetic resonance. Recombinant AP-FXIII was largely flexible both in plasma and water, differing significantly from the rigid structure in the bound state. We suggest that the recognized epitope is either occluded in the noncleaved form or possesses a structure that does not allow binding to the antibodies. On the basis of our findings, we propose AP-FXIII as a possible new marker for acute thrombotic events.