1000 resultados para DIMORPHIC PROCESS


Relevância:

60.00% 60.00%

Publicador:

Resumo:

P>We have developed a two-step PCR assay that amplifies a region of the ceja-1 sequence that is specific for virulent strains of Paracoccidioides brasiliensis. An internal region of the ceja-1 sequence was chosen for designing primers that were utilised in a single tube heminested PCR protocol to amplify DNA from six virulent strains. PCR specificity was determined by the absence of amplified products with genomic DNA from four non-virulent strains of P. brasiliensis and from eight fungal pathogens, one bacterium, two protozoa, one worm and mouse and human genomic DNA (leucocytes). The fact that the PCR product was only obtained with the genetic material from virulent isolates of P. brasiliensis suggested that this partial amplified sequence might be a marker of virulence for this fungus. The diagnostic potential of this PCR was confirmed by the successful amplification of this fragment with genomic DNA obtained in lymph node aspirate from a patient with paracoccidioidomycosis.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The production of mature germ cells capable of generating totipotent zygotes is a highly specialized and sexually dimorphic process. The transition from diploid primordial germ cell to haploid spermatozoa requires genome-wide reprogramming of DNA methylation, stage- and testis-specific gene expression, mitotic and meiotic division, and the histone-protamine transition, all requiring unique epigenetic control. Dnmt3L, a DNA methyltransferase regulator, is expressed during gametogenesis, and its deletion results in sterility. We found that during spermatogenesis, Dnmt3L contributes to the acquisition of DNA methylation at paternally imprinted regions, unique nonpericentric heterochromatic sequences, and interspersed repeats, including autonomous transposable elements. We observed retrotransposition of an LTR-ERV1 element in the DNA from Dnmt3L(-/-) germ cells, presumably as a result of hypomethylation. Later in development, in Dnmt3L(-/-) meiotic spermatocytes, we detected abnormalities in the status of biochemical markers of heterochromatin, implying aberrant chromatin packaging. Coincidentally, homologous chromosomes fail to align and form synaptonemal complexes, spermatogenesis arrests, and spermatocytes are lost by apoptosis and sloughing. Because Dnmt3L expression is restricted to gonocytes, the presence of defects in later stages reveals a mechanism whereby early genome reprogramming is linked inextricably to changes in chromatin structure required for completion of spermatogenesis.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In order to determine the role of lysozyme, an antimicrobial peptide belonging to the innate immune system, against the dimorphic fungus Paracoccidioides brasiliensis, co-cultures of the MH-S murine alveolar macrophages cell line with P. brasiliensis conidia were done; assays to evaluate the effect of physiological and inflammatory concentrations of lysozyme directly on the fungus life cycle were also undertaken. We observed that TNF-α-activated macrophages significantly inhibited the conidia to yeast transition (p = 0.0043) and exerted an important fungicidal effect (p = 0.0044), killing 27% more fungal propagules in comparison with controls. Nonetheless, after adding a selective inhibitor of lysozyme, the fungicidal effect was reverted. When P. brasiliensis propagules were exposed directly to different concentrations of lysozyme, a dual effect was observed. Physiologic concentrations of the enzyme facilitated the conidia-to-yeast transition process (p < 0.05). On the contrary, inflammatory concentrations impaired the normal temperature-dependant fungal transition (p < 0.0001). When yeast cells were exposed to lysozyme, irrespective of concentration, the multiple-budding ability was badly impaired (p < 0.0001). In addition, ultra-structural changes such as subcellular degradation, fusion of lipid vacuoles, lamellar structures and interruption of the fibrilar layer were observed in lysozyme exposed conidia. These results suggest that lysozyme appears to exert a dual role as part of the anti-P. brasiliensis defense mechanisms.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Systemic lupus erythematosus is an autoimmune disease that causes many psychological repercussions that have been studied through qualitative research. These are considered relevant, since they reveal the amplitude experienced by patients. Given this importance, this study aims to map the qualitative production in this theme, derived from studies of experiences of adult patients of both genders and that had used as a tool a semi-structured interview and/or field observations, and had made use of a sampling by a saturation criterion to determine the number of participants in each study. The survey was conducted in Pubmed, Lilacs, Psycinfo e Cochrane databases, searching productions in English and Portuguese idioms published between January 2005 and June 2012. The 19 revised papers that have dealt with patients in the acute phase of the disease showed themes that were categorized into eight topics that contemplated the experienced process at various stages, from the onset of the disease, extending through the knowledge of the diagnosis and the understanding of the manifestations of the disease, drug treatment and general care, evolution and prognosis. The collected papers also point to the difficulty of understanding, of the patients, on what consists the remission phase, revealing also that this is a clinical stage underexplored by psychological studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

20

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

PURPOSE: To investigate the facial symmetry of rats submitted to experimental mandibular condyle fracture and with protein undernutrition (8% of protein) by means of cephalometric measurements. METHODS: Forty-five adult Wistar rats were distributed in three groups: fracture group, submitted to condylar fracture with no changes in diet; undernourished fracture group, submitted to hypoproteic diet and condylar fracture; undernourished group, kept until the end of experiment, without condylar fracture. Displaced fractures of the right condyle were induced under general anesthesia. The specimens were submitted to axial radiographic incidence, and cephalometric mensurations were made using a computer system. The values obtained were subjected to statistical analyses among the groups and between the sides in each group. RESULTS: There was significative decrease of the values of serum proteins and albumin in the undernourished fracture group. There was deviation of the median line of the mandible relative to the median line of the maxilla, significative to undernutrition fracture group, as well as asymmetry of the maxilla and mandible, in special in the final period of experiment. CONCLUSION: The mandibular condyle fracture in rats with proteic undernutrition induced an asymmetry of the mandible, also leading to consequences in the maxilla.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study evaluated the effect of specimens' design and manufacturing process on microtensile bond strength, internal stress distributions (Finite Element Analysis - FEA) and specimens' integrity by means of Scanning Electron Microscopy (SEM) and Laser Scanning Confocal Microscopy (LCM). Excite was applied to flat enamel surface and a resin composite build-ups were made incrementally with 1-mm increments of Tetric Ceram. Teeth were cut using a diamond disc or a diamond wire, obtaining 0.8 mm² stick-shaped specimens, or were shaped with a Micro Specimen Former, obtaining dumbbell-shaped specimens (n = 10). Samples were randomly selected for SEM and LCM analysis. Remaining samples underwent microtensile test, and results were analyzed with ANOVA and Tukey test. FEA dumbbell-shaped model resulted in a more homogeneous stress distribution. Nonetheless, they failed under lower bond strengths (21.83 ± 5.44 MPa)c than stick-shaped specimens (sectioned with wire: 42.93 ± 4.77 MPaª; sectioned with disc: 36.62 ± 3.63 MPa b), due to geometric irregularities related to manufacturing process, as noted in microscopic analyzes. It could be concluded that stick-shaped, nontrimmed specimens, sectioned with diamond wire, are preferred for enamel specimens as they can be prepared in a less destructive, easier, and more precise way.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Nitric oxide (NO) has been considered a key molecule in infammation. OBJECTIVE: The aim of this study was to evaluate the effect of treatment with L-NAME and sodium nitroprussiate, substances that inhibit and release NO, respectively, on tissue tolerance to endodontic irrigants. MATERIAL AND METHODS: The vital dye exudation method was used in a rat subcutaneous tissue model. Injections of 2% Evans blue were administered intravenously into the dorsal penial vein of 14 male rats (200-300 g). The NO inhibitor and donor substances were injected into the subcutaneous tissue in the dorsal region, forming two groups of animals: G1 was inoculated with L-NAME and G2 with sodium nitroprussiate. Both groups received injections of the test endodontic irrigants: acetic acid, 15% citric acid, 17% EDTA-T and saline (control). After 30 min, analysis of the extravasated dye was performed by light absorption spectrophotometry (620 nm). RESULTS: There was statistically signifcant difference (p<0.05) between groups 1 and 2 for all irrigants. L-NAME produced a less intense infammatory reaction and nitroprussiate intensifed this process. CONCLUSIONS: Independently of the administration of NO inhibitors and donors, EDTA-T produced the highest irritating potential in vital tissue among the tested irrigating solutions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We study how the crossover exponent, phi, between the directed percolation (DP) and compact directed percolation (CDP) behaves as a function of the diffusion rate in a model that generalizes the contact process. Our conclusions are based in results pointed by perturbative series expansions and numerical simulations, and are consistent with a value phi = 2 for finite diffusion rates and phi = 1 in the limit of infinite diffusion rate.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A modified method for the calculation of the normalized faradaic charge (q fN) is proposed. The method involves the simulation of an oxidation process, by cyclic voltammetry, by employing potentials in the oxygen evolution reaction region. The method is applicable to organic species whose oxidation is not manifested by a defined oxidation peak at conductive oxide electrodes. The variation of q fN for electrodes of nominal composition Ti/RuX Sn1-X O2 (x = 0.3, 0.2 and 0.1), Ti/Ir0.3Ti0.7O2 and Ti/Ru0.3Ti0.7O2 in the presence of various concentrations of formaldehyde was analyzed. It was observed that electrodes containing SnO2 are the most active for formaldehyde oxidation. Subsequently, in order to test the validity of the proposed model, galvanostatic electrolyses (40 mA cm-2) of two different formaldehyde concentrations (0.10 and 0.01 mol dm-3) were performed. The results are in agreement with the proposed model and indicate that this new method can be used to determine the relative activity of conductive oxide electrodes. In agreement with previous studies, it can be concluded that not only the nature of the electrode material, but also the organic species in solution and its concentration are important factors to be considered in the oxidation of organic compounds.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work describes the infrared spectroscopy characterization and the charge compensation dynamics in supramolecular film FeTPPZFeCN derived from tetra-2-pyridyl-1,4-pyrazine (TPPZ) with hexacyanoferrate, as well as the hybrid film formed by FeTPPZFeCN and polypyrrole (PPy). For supramolecular film, it was found that anion flux is greater in a K+ containing solution than in Li+ solution, which seems to be due to the larger crystalline ionic radius of K+. The electroneutralization process is discussed in terms of electrostatic interactions between cations and metallic centers in the hosting matrix. The nature of the charge compensation process differs from others modified electrodes based on Prussian blue films, where only cations such as K+ participate in the electroneutralization process. In the case of FeTPPZFeCN/PPy hybrid film, the magnitude of the anions’s flux is also dependent on the identity of the anion of the supporting electrolyte.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A new species of the formerly monotypic genus Trichogenes is described from a high-altitude stream of the rio Itapemirim system, an isolated Atlantic drainage in the State of Espírito Santo, southeastern Brazil. Trichogenes claviger, new species, differs from all other trichomycterids by the sexually dimorphic posterior process of the opercle, much elongated in males; the terminal mouth; the deeply bifurcated anterior neural spines and the presence of a large anterodorsal claw-like process on the neural arches of the anterior four free vertebrae. The new species also differs from its only congener, T. longipinnis, by a number of additional traits, including the the lack of branched anal-fin rays in specimens of any size; the broader than long posterior nostril; the deeper head (head depth 72.9-86.6% HL); the presence of a fine dark line along the base of the anal fin; the lack of dark spots on cheeks; the shape of the interopercle; the presence of odontodes on a bony expansion on the posterodorsal margin of the interopercle; the fewer vertebrae (35); the absence of an antorbital; and the fewer pleural ribs (eight). Small juveniles of the new species are also strikingly different from those of all other Trichomycteridae, including T. longipinnis, having a very large lateral eye, an upturned mouth, and compressed head. Trichogenes claviger occurs in shaded sectors of a blackwater sluggish stream with sandy substrate and patchy accumulations of vegetable debris, a habitat markedly different from the rocky torrential environment known for T. longipinnis. A comparison of the internal anatomy of the two species provides the basis for a hypothesis of a monophyletic Trichogenes. Data from the new species further support a sister-group relationship between Trichogeninae and Copionodontinae, as well as the position of that clade as sister group to all remaining Trichomycteridae.