958 resultados para Cd(II)complexes


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Five coordination compounds Zn(mbmpbi)(2)Cl-2 (1), Zn(mbmpbi)(2)Br-2 (2), Cd(mbmpbi)(2)Cl-2 (3), Hg(mbmpbi)(2)Cl-2 (4) and Hg(mbmpbi)(2)Br-2 (5) were synthesized by the reaction of 1-(p-methoxybenzyl)-2-(p-methoxyphenyl)benzimidazole (mbmpbi) with the corresponding metal halides. The complexes have been characterized by elemental analysis, conductance measurements, FT-IR, H-1 NMR and photoluminescence spectral studies. The ligand mbmpbi exhibits the N-benzimidazole coordination. The structures of 3-5 have been determined by single crystal X-ray diffraction. These three complexes are isostructural, crystallizing in the monoclinic system. P2/n space group with a distorted tetrahedral geometry around the metal ion. Zn(II) and Cd(II) complexes show strong blue emission in solid state at room temperature. (C) 2011 Elsevier Ltd. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The reaction of Cu(II), Zn(II), Cd(II) and Hg(II) chlorides and bromides with imidazoline-2-thione (IZT) and its N-methyl derivative (NMIZT) yields complexes of stoichiometry ML3X2 and ML2X (IZT) and its N-methyl derivative (NMIZT) yields complexes of stoichiometry ML3X2 and ML2X (where M=Cu(I)); copper(II) halides yield Cu(I) complexes. On the basis of infrared and 13C n.m.r.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Proton and carbon-13 NMR has been used to study complexes of 2-pyridinethione (in its basic and deprotonated forms) and 4-pyridinethione with zinc(II), cadmium(II) and mercury(II) halides. The variations in the carbon-13 and proton chemical shifts are discussed.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Metal complexes of thiazoles have been studied in recent years[I-3] because of their biochemical importance[4,5]. However, data on metal complexes of thiazole derivatives containing another coordinating function are limited[2]. We have synthesized and examined the donor characteristics of a new ligand, 2-thioacetamide thiazole (TATZ)(I) towards chlorides and bromides of Zn(II), Cd(II), Hg(II) and Cu(I). The presence of four potential donor atoms and extensive charge delocalization should render TATZ a versatile ligand.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The zinc and cadmium ethylxanthate complexes of N,N,N',N'-tetramethylethylenediamine (TMEDA), [M(S2COEt)(2)TMEDA], were synthesized and characterized with infrared, H-1 and C-13 NMR spectroscopy, mass spectrometry and X-ray crystallography. Whereas the cadmium complex has a six-coordinate {CdS4N2} centre with bidentate xanthate ligands, the zinc complex contains four coordinate {ZnS2N2} zinc with two monodentate xanthate groups. The cadmium species [Cd(S2COEt)(2)(diamine)] (where diamine = N,N-dimethylethylenediamine or N,N'-diisopropylethylenediamine) were also synthesized. The surfactant-assisted formation of nanoparticles from [Cd(S2COEt)(2)] and [Cd(S2COEt)(2)TMEDA] was studied with TEM, XRD and XRF techniques. From [Cd(S2COEt)(2)], spherical nanoparticle aggregates 140-200 nm in diameter were obtained but from [Cd(S2COEt)(2)TMEDA], single nanoparticles were produced with estimated diameters in the range of 4-7 nm and almost no aggregation. (C) 2004 Elsevier Ltd. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We describe here a procedure to bridge the gap in the field of calixarene physicochemistry between solid-state atomic-resolution structural information and the liquid-state low-resolution thermodynamics and spectroscopic data. We use MD simulations to study the kinetics and energetics involved in the complexation of lower rim calix[4]arene derivatives (L), containing bidentate ester (1) and ketone (2) pendant groups, with acetonitrile molecule (MeCN) and Cd2+ and Pb2+ ions (M2+) in acetonitrile solution. On one hand, we found that the prior inclusion of MeCN into the calix to form a L(MeCN) adduct has only a weak effect in preorganizing the hydrophilic cavity toward metal ion binding. On the other hand, the strong ion-hydrophilic cavity interaction produces a wide open calix which enhances the binding of one MeCN molecule (allosteric effect) to stabilize the whole (M2+)1(MeCN) bifunctional complex. We reach two major conclusions: (i) the MD results for the (M2+)1(MeCN) binding are in close agreement with the ""endo"", fully encapsulated, metal complex found by X-ray diffraction and in vacuo MD calculations, and (ii) the MD structure for the more flexible 2 ligand, however, differs from the also endo solid-state molecule. In fact, it shows strong solvation effects at the calixarene lower bore by competing MeCN molecules that share the metal coordination sphere with the four C=O oxygens of an ""exo"" (M2+)2(MeCN) complex.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Synthesis and characterization, including data on thermal decomposition, are reported for the complexes of S,S'-methylenebis(cysteine) (djenkolic acid) with copper(II), zinc(II) and cadmium(II): CuC(7)H(12)N(2)O(4)S(2) [I]; ZnC(7)H(12)N(2)O(4)S(2) [II] and CdC(7)H(12)N(2)O(4)S(2) [III] X-ray diffraction showed that the compounds are isostructural and belong to a monoclinic system. According to IR spectra, COO, NH(2) groups and bridging sulfur atoms are the main coordination sites.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Al13 pillared montmorillonites (AlPMts) prepared with different Al/clay ratios were used to remove Cd(II) and phosphate from aqueous solution. The structure of AlPMts was characterized by X-ray diffraction (XRD), Thermogravimetric analysis (TG), and N2 adsorption–desorption. The basal spacing, intercalated amount of Al13 cations, and specific surface area of AlPMts increased with the increase of the Al/clay ratio. In the single adsorption system, with the increase of the Al/clay ratio, the adsorption of phosphate on AlPMts increased but that of Cd(II) decreased. Significantly enhanced adsorptions of Cd(II) and phosphate on AlPMts were observed in a simultaneous system. For both contaminants, the adsorption of one contaminant would increase with the increase of the initial concentration of the other one and increase in the Al/clay ratio. The enhancement of the adsorption of Cd(II) was much higher than that of phosphate on AlPMt. This suggests that the intercalated Al13 cations are the primary co-adsorption sites for phosphate and Cd(II). X-ray photoelectron spectroscopy (XPS) indicated comparable binding energy of P2p but a different binding energy of Cd3d in single and simultaneous systems. The adsorption and XPS results suggested that the formation of P-bridge ternary surface complexes was the possible adsorption mechanism for promoted uptake of Cd(II) and phosphate on AlPMt.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A series of macrobicyclic dizinc(II) complexes Zn2L1-2B](ClO4)(4) (1-6) have been synthesized and characterized (L1-2 are polyaza macrobicyclic binucleating ligands, and B is the N,N-donor heterocyclic base (viz. 2,2'-bipyridine (bipy) and 1,10-phenanthroline (phen)). The DNA and protein binding, DNA hydrolysis and anticancer activity of these complexes were investigated. The interactions of complexes 1-6 with calf thymus DNA were studied by spectroscopic techniques, including absorption, fluorescence and CD spectroscopy. The DNA binding constant values of the complexes were found to range from 2.80 x 10(5) to 5.25 x 10(5) M-1, and the binding affinities are in the following order: 3 > 6 > 2 > 5 > 1 > 4. All the dizinc(II) complexes 1-6 are found to effectively promote the hydrolytic cleavage of plasmid pBR322 DNA under anaerobic and aerobic conditions. Kinetic data for DNA hydrolysis promoted by 3 and 6 under physiological conditions give observed rate constants (k(obs)) of 5.56 +/- 0.1 and 5.12 +/- 0.2 h(-1), respectively, showing a 10(7)-fold rate acceleration over the uncatalyzed reaction of dsDNA. Remarkably, the macrobicyclic dizinc(II) complexes 1-6 bind and cleave bovine serum albumin (BSA), and effectively promote the caspase-3 and caspase-9 dependent deaths of HeLa and BeWo cancer cells. The cytotoxicity of the complexes was further confirmed by lactate dehydrogenase enzyme levels in cancer cell lysate and content media.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Five zinc (II) complexes (1-5) with 4 '-phenyl-2,2 ':6 ',2 ''-terpyridine (ptpy) derivatives as ligands have been synthesized and fully characterized. The para-position of phenyl in ptpy is substituted by the group (R), i.e. tert-butyl (t-Bu), hexyloxy (OHex), carbazole-9-yl (Cz), naphthalen-1-yl-phenyl-amine-N-yl (NPA) and diphenyl amine-N-yl (DPA), with different electron-donating ability. With increasing donor ability of the R, the emission color of the complexes in film was modulated from violet (392 nm) to reddish orange (604 nm). The photoexcited luminescence exhibits significant solvatochromism because the emission of the complexes involves the intra-ligand charge transfer (ILCT) excited state. The electrochemical investigations show that the complexes with stronger electro-donating substituent have lower oxidation potential and then higher HOMO level. The electroluminescence (EL) properties of these zinc (II) complexes were studied with the device structure of ITO/PEDOT/Zn (II) complex: PBD:PMMA/BCP/AlQ/ LiF/Al. Complexes 3, 4 and 5 exhibit EL wavelength at 552, 600 and 609 nm with maximum current efficiency of 5.28, 2.83 and 2.00 cd/A, respectively.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Three new compounds, [ZnL1.5(H2O)(SO4)]. 6H(2)O 1, [ZnL1.5(H2O)(2)][NO3](2). 2H(2)O 2 and [CdL1.5(H2O)(2)(SO4)]. 4H(2)O 3 were obtained from self-assembly of the corresponding metal salts with 1,1'-(1,4-butanediyl)bis(imidazole) (L). In both 1 and 2 zinc ion is five-co-ordinated, showing a less-common trigonal bipyramidal co-ordination polyhedron, while cadmium ion of 3 is six-co-ordinated with a common octahedral arrangement. The sulfate ions of 1 and 3 are co-ordinated, however the nitrate ions of 2 are not. Each of the three compounds is composed of a (6, 3) network with the hexagonal smallest circuit containing six metal ions and six L; each L is co-ordinated to two metal ions, acting as a bridging ligand. In 1 the 2-D sheet of (6, 3) networks is interpenetrated in an inclined mode by symmetry related, identical sheets to give an interlocked 3-D structure, while the (6, 3) networks of both 2 and 3 stack in a parallel fashion to construct frameworks having channels.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Two new cadmium (II) complexes [Cd(hmt)(dca)(2)] (n) (1) and [Cd-3(hmt)(2)(SeCN)(6)(H2O)(2)] (n) (2) (hmt=hexamethylenetetramine, dca=dicyanamide) have been synthesized and characterized by X-ray single-crystal analysis. The complex 1 is a 2D rectangular grid of octahedral cadmium (II) with CdN6 chromophore where cadmium centers are doubly bridged by dicyanamide and hmt along a-axis, which are interlinked by dicyanamide running along c-axis. Whereas, complex 2 is a 1D chain of octahedral cadmium (II) with a three-leg ladder topology running along a-axis. The Cd(II) centers are doubly bridged through SeCN (infinite rail) along a-axis and singly bridged by hmt (two-step rung) along c-axis, having cadmium centers with CdSe2N3O and CdSe2N4 chromophores. The adjacent chains through H-bonding between coordinated water and hmt, and (SeSe)-Se-... interaction are extended to 2D supramolecular architecture.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Four new trinuclear hetero-metallic nickel(II)-cadmium(II) complexes [(NiL)(2)Cd(NCS)(2)] (1A and 1B), [(NiL)(2)Cd(NCO)(2)] (2) and [(NiL)(2)Cd(N-3)(2)] (3) have been synthesized using [NiL] as a so-called "ligand complex" (where H2L = N,N'-bis(salicylidene)-1,3-propanediamine) and structurally characterized. Crystal structure analyses reveal that all four complexes contain a trinuclear moiety in which two square planar [NiL] units are bonded to a central cadmium(II) ion through double phenoxido bridges. The Cd(II) is in a six-coordinate distorted octahedral environment being bonded additionally to two mutually cis nitrogen atoms of terminal thiocyanate (in 1A and 1B), cyanate (in 2) and azide (in 3). Complexes 1A and 1B have the same molecular formula but crystallize in very different monoclinic unit cells and can be considered as polymorphs. On the other hand, the two isoelectronic complexes 2 and 3 are indeed isomorphous and crystallize only in one form. Their conformation is similar to that observed in 1A.