960 resultados para Blow fly


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The effects of eucalyptol were evaluated against the house fly, Musca domestica L., and blow fly, Chrysomya megacephala (F.). The bioassay of adults, using topical application, indicated that M. domestica males were more susceptible than females, with the LD50 being 118 and 177 µg/fly, respectively. A higher LD50 of C. megacephala was obtained; 197 µg/fly for males and 221 µg/fly for females. Living flies of both species yielded a shorter life span after being treated with eucalyptol. The bioassay of larvae, using the dipping method on the third instar, showed that M. domestica was more susceptible than C. megacephala, with their LC50 being 101 and 642 µg/µl, respectively. The emergence of adults, which had been treated with eucalyptol in larvae, decreased only in M. domestica. Having the volatile property, fumigation or impregnated paper test of eucalyptol or the efficacy of repellence or attractiveness merits further investigations to enhance bio-insecticidal efficacy.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The ultrastructural superficial changes in third instar house fly (Musca domestica) and blow fly (Chrysomya megacephala) induced by eucalyptol oil were observed using scanning electron microscopy. Dipped in 0.902 g/ml eucalyptol for 30 sec, the larvae integument of both species showed significant aberrant appearance of the body surface, particularly swelling integument, bleb formation, partial breach and deformation of spines.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This work investigated the effects of butylscopolamine bromide, a drug present in the pharmaceutical formulation Buscopan((R)), on the development of Chrysomya megacephala, a blow fly species of considerable forensic and medical importance in Brazil. Larvae exposed to the drug showed a decreased rate of development, with higher drug concentrations further retarding the development. Besides, larvae reared on the presence of the drug showed smaller body weight and body length when compared with larvae reared on the absence of Buscopan((R)). The drug also affected the mortality of the species.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

An expansion of the author's previous memoir on the subject, that appeared in 1870.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

During the annual fly survey at Doi Nang Kaew in Doi Saket District, Chiang Mai Province of Thailand in 2011, Isomyia paurogonitaFang & Fan, 1986 (Diptera: Calliphoridae) and Sumatria latifrons Malloch, 1926 (Diptera: Calliphoridae) were collected for the first time in Thailand. They are the rare species of the subfamily Rhiniinae (tribe Cosminini). Prior to this finding, fifteen species of Isomyia and two species of Sumatriawere recorded from Thailand. Therefore, 96 blow fly species have been found in this country. These new locality records of both flies are very important for further research on their biology and ecology in Thailand.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

First record of Chrysomya rufifacies (Macquart) (Diptera, Calliphoridae) from Brazil. In addition to its native fauna, the Neotropical region is known to be inhabited by four introduced species of blow flies of the genus Chrysomya. Up until now, only three of these species have been recorded in Brazil - Chrysomya albiceps (Wiedemann), Chrysomya megacephala (Fabricius), and Chrysomya putoria (Wiedemann). In South America, C. rufifacies (Macquart) has only been reported from Argentina and Colombia. This study records C. rufifacies from Brazil for the first time. The specimens were collected in an area of cerrado (savanna-like vegetation) in the municipality of Caxias in state of Maranhão, and were attracted by pig carcasses.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Previous Iowa DOT sponsored research has shown that some Class C fly ashes are ementitious (because calcium is combined as calcium aluminates) while other Class C ashes containing similar amounts of elemental calcium are not (1). Fly ashes from modern power plants in Iowa contain significant amounts of calcium in their glassy phases, regardless of their cementitious properties. The present research was based on these findings and on the hyphothesis that: attack of the amorphous phase of high calcium fly ash could be initiated with trace additives, thus making calcium available for formation of useful calcium-silicate cements. Phase I research was devoted to finding potential additives through a screening process; the likely chemicals were tested with fly ashes representative of the cementitious and non-cementitious ashes available in the state. Ammonium phosphate, a fertilizer, was found to produce 3,600 psi cement with cementitious Neal #4 fly ash; this strength is roughly equivalent to that of portland cement, but at about one-third the cost. Neal #2 fly ash, a slightly cementitious Class C, was found to respond best with ammonium nitrate; through the additive, a near-zero strength material was transformed into a 1,200 psi cement. The second research phase was directed to optimimizing trace additive concentrations, defining the behavior of the resulting cements, evaluating more comprehensively the fly ashes available in Iowa, and explaining the cement formation mechanisms of the most promising trace additives. X-ray diffraction data demonstrate that both amorphous and crystalline hydrates of chemically enhanced fly ash differ from those of unaltered fly ash hydrates. Calciumaluminum- silicate hydrates were formed, rather than the expected (and hypothesized) calcium-silicate hydrates. These new reaction products explain the observed strength enhancement. The final phase concentrated on laboratory application of the chemically-enhanced fly ash cements to road base stabilization. Emphasis was placed on use of marginal aggregates, such as limestone crusher fines and unprocessed blow sand. The nature of the chemically modified fly ash cements led to an evaluation of fine grained soil stabilization where a wide range of materials, defined by plasticity index, could be stabilized. Parameters used for evaluation included strength, compaction requirements, set time, and frost resistance.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The addition of a selected self-cementing, Class C fly ash to blow sand soils improves their compacted strength greatly as opposed to the minimal strength improvement when fly ash is mixed with loess soil. By varying the percentage of fly ash added, the resulting blow sand-fly ash mixture can function as a low strength stabilized material or as a higher strength sub-base. Low strength stabilized material can also be obtained by mixing loess soils with a selected Class C fly ash. The development of the higher strength values required for subbase materials is very dependent upon compaction delay time and moisture condition of the material. Results at this time indicate that, when compaction delays are involved, excess moisture in the material has the greatest positive effect in achieving minimum strengths. Other added retarding agents, such as borax and gypsum, have less effect.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: The work was conducted to study phlebotomine fauna (Diptera: Psychodidae) and aspects of American cutaneous leishmaniasis transmission in a forested area where Leishmania (Leishmania) amazonensis occurs, situated in the municipality of Bela Vista, State of Mato Grosso do Sul, Brazil. METHODS: The captures were conducted with modified Disney traps, using hamster (Mesocricetus auratus) as bait, from May 2004 to January 2006. RESULTS: Ten species of phlebotomine sandflies were captured: Brumptomyia avellari, Brumptomyia brumpti, Bichromomyia flaviscutellata, Evandromyia bourrouli, Evandromyia lenti, Lutzomyia longipalpis, Psathyromyia campograndensis, Psathyromyia punctigeniculata, Psathyromyia shannoni and Sciopemyia sordellii. The two predominant species were Ev bourrouli (57.3%) and Bi flaviscutellata (41.4%), present at all sampling sites. Two of the 36 hamsters used as bait presented natural infection with Leishmania. The parasite was identified as Leishmania (Leishmania) amazonensis. CONCLUSIONS: Analysis of the results revealed the efficiency of Disney traps for capturing Bichromomyia flaviscutellata and the simultaneous presence of both vector and the Leishmania species transmitted by the same can be considered a predictive factor of the occurrence of leishmaniasis outbreaks for the human population that occupies the location.