Revision of the New World bee fly genus Heterostylum Macquart (Diptera, Bombyliidae, Bombyliinae)

The genus Heterostylum Macquart and five Neotropical species (H. ferrugineum (Fabricius, 1805), H. hirsutum (Thunberg, 1827), H. rufum (Olivier, 1789), H. haemorrhoicum (Loew, 1863) and H. pallipes Bigot, 1892) are redescribed. The other species, recently redescribed or described are only diagnosed, except for H. deani Painter, 1930, whose spermathecae are described and illustrated for the first time. The main characters of the external morphology were photographed and the male genitalia and female spermathecae illustrated. An identification key to all included species is also presented.

Biogeographic analysis of Crocidiinae (Diptera, Bombyliidae): finding congruence among morphological, molecular, fossil and paleogeographical data

Biogeographic studies dealing with Bombyliidae are rare in the literature and no information is available on its origin and early diversification. In this study, we found evidence from molecular phylogeny and from fossil record supporting a Middle Jurassic origin of the Bombylioidea, taken as a starting point to discuss the biogeography and diversification of Crocidiinae. Based on a previously published phylogenetic hypothesis, we performed a Brooks Parsimony Analysis (BPA) to discuss the biogeographical history of Crocidiinae lineages. This subfamily is mostly distributed over arid areas of the early components of the Gondwanaland: Chile and southern Africa, but also in southwestern Palaearctic and southwestern Nearctic. The vicariant events affecting the Crocidiinae biogeography at the generic level seems to be related to the sequential separation of a Laurasian clade from a Gondwanan clade followed by the splitting of the latter into smaller components. This also leads to a hypothesis of origin of the Crocidiinae in the Middle Jurassic, the same period in which other bombyliid lineages are supposed to have arisen and irradiated.

Intraspecific queen parasitism in a highly eusocial bee

Insect societies are well-known for their advanced cooperation, but their colonies are also vulnerable to reproductive parasitism. Here, we present a novel example of an intra-specific social parasitism in a highly eusocial bee, the stingless bee Melipona scutellaris. In particular, we provide genetic evidence which shows that, upon loss of the mother queen, many colonies are invaded by unrelated queens that fly in from unrelated hives nearby. The reasons for the occurrence of this surprising form of social parasitism may be linked to the fact that unlike honeybees, Melipona bees produce new queens in great excess of colony needs, and that this exerts much greater selection on queens to seek alternative reproductive options, such as by taking over other nests. Overall, our results are the first to demonstrate that queens in highly eusocial bees can found colonies not only via supersedure or swarming, but also by infiltrating and taking over other unrelated nests.

Larval development of Physocephala (Diptera, Conopidae) in the bumble bee Bombus morio (Hymenoptera, Apidae)

Larval development of Physocephala (Diptera, Conopidae) in the bumble bee Bombus morio (Hymenoptera, Apidae). In the summer of 2012, a high incidence of conopid larvae was observed in a sample of female B. morio collected in remaining fragments of semidecidual forest and Cerrado, in the municipality of Sorocaba, state of São Paulo, Brazil. The larval development of conopid flies was studied, beginning at the larval instars (LO to L3) and PUP, until the emergence of the imago under laboratory conditions and inside the host. At the first instar, or LO, the microtype larvae measured less than 1 mm in length. During the transition from L1 to L3, the larvae grew in length. At L3, the larvae doubled their length (4 mm) and then started to develop both in length and width, reaching the PUP stage with 10 mm in length and 7 mm in width. The main characteristic that differentiates L3 from the early instars is the larger body size and the beginning of posterior spiracle development. The development from PUP to puparium took less than 24h. The bees died ten days after the fly oviposition, or just before full PUP development. The early development stages (egg-LO to L1) were critical for larva survival. The pupa was visible between the intersegmental sternites and, 32 days after pupation, a female imago of Physocephala sp. emerged from one bee. The puparium and the fly measured approximately 10 mm in length. In a single day of collection, up to 45% of the bumble bees collected were parasitized by conopid flies.

Developmental Rate Of Immatures Of Two Fly Species Of Forensic Importance: Sarcophaga (liopygia) Ruficornis And Microcerella Halli (diptera: Sarcophagidae).

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae) fruit-fly species and their hybrids

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

The mitochondrial genome of the stingless bee Melipona bicolor (Hymenoptera, Apidae, Meliponini): sequence, gene organization and a unique tRNA translocation event conserved across the tribe Meliponini

At present a complete mtDNA sequence has been reported for only two hymenopterans, the Old World honey bee, Apis mellifera and the sawfly Perga condei. Among the bee group, the tribe Meliponini (stingless bees) has some distinction due to its Pantropical distribution, great number of species and large importance as main pollinators in several ecosystems, including the Brazilian rain forest. However few molecular studies have been conducted on this group of bees and few sequence data from mitochondrial genomes have been described. In this project, we PCR amplified and sequenced 78% of the mitochondrial genome of the stingless bee Melipona bicolor (Apidae, Meliponini). The sequenced region contains all of the 13 mitochondrial protein-coding genes, 18 of 22 tRNA genes, and both rRNA genes (one of them was partially sequenced). We also report the genome organization (gene content and order), gene translation, genetic code, and other molecular features, such as base frequencies, codon usage, gene initiation and termination. We compare these characteristics of M. bicolor to those of the mitochondrial genome of A. mellifera and other insects. A highly biased A+T content is a typical characteristic of the A. mellifera mitochondrial genome and it was even more extreme in that of M. bicolor. Length and compositional differences between M. bicolor and A. mellifera genes were detected and the gene order was compared. Eleven tRNA gene translocations were observed between these two species. This latter finding was surprising, considering the taxonomic proximity of these two bee tribes. The tRNA Lys gene translocation was investigated within Meliponini and showed high conservation across the Pantropical range of the tribe.

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

Notes on oil sources for the bee genus Caenonomada(Hymenoptera, Apidae, Tapinotaspidini)

It is reported for the first time oil collecting by bees of the genus Caenonomada on flowers of Plantaginaceae. Females of Caenonomada unicalcarata were observed collecting oil on flowers of Angelonia cornigera, and males and females of Caenonomada bruneri and C. aff. unicalcarata were observed on flowers of Angelonia and Monopera (Plantaginaceae). The record of Caenonomada on Plantaginaceae suggests the use of trichomatic oil glands as a primitive condition in the tribe Tapinotaspidini.

Sand fly captures with Disney traps in area of occurrence of Leishmania (Leishmania) amazonensis in the state of Mato Grosso do Sul, mid-western Brazil

INTRODUCTION: The work was conducted to study phlebotomine fauna (Diptera: Psychodidae) and aspects of American cutaneous leishmaniasis transmission in a forested area where Leishmania (Leishmania) amazonensis occurs, situated in the municipality of Bela Vista, State of Mato Grosso do Sul, Brazil. METHODS: The captures were conducted with modified Disney traps, using hamster (Mesocricetus auratus) as bait, from May 2004 to January 2006. RESULTS: Ten species of phlebotomine sandflies were captured: Brumptomyia avellari, Brumptomyia brumpti, Bichromomyia flaviscutellata, Evandromyia bourrouli, Evandromyia lenti, Lutzomyia longipalpis, Psathyromyia campograndensis, Psathyromyia punctigeniculata, Psathyromyia shannoni and Sciopemyia sordellii. The two predominant species were Ev bourrouli (57.3%) and Bi flaviscutellata (41.4%), present at all sampling sites. Two of the 36 hamsters used as bait presented natural infection with Leishmania. The parasite was identified as Leishmania (Leishmania) amazonensis. CONCLUSIONS: Analysis of the results revealed the efficiency of Disney traps for capturing Bichromomyia flaviscutellata and the simultaneous presence of both vector and the Leishmania species transmitted by the same can be considered a predictive factor of the occurrence of leishmaniasis outbreaks for the human population that occupies the location.

OFFSPRING IN RESPONSE TO PARENTAL FEMALE DENSITIES IN THE FRUIT FLY PARASITOID DIACHASMIMORPHA LONGICAUDATA (HYMENOPTERA: BRACONIDAE: OPIINAE)

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.

A scientific note about spectroscopic analysis of honey bee brood comb cappings in hygienic and non-hygienic honey bee colonies

Coordenacao de Aperfeicoamento de Pessoal de Nivel Superior (CAPES)

Phoretic mites (Acari: Chaetodactylidae) associated with the solitary bee Tetrapedia diversipes (Apidae: Tetrapediini)

Solitary bees of the genus Tetrapedia have a specific association with mites of the genus Roubikia (Chaetodactylidae). These mites are frequently found attached to active Tetrapedia bees. We quantified the number of mites on individuals of Tetrapedia diversipes Klug and examined the interaction between these species. Nests of T. diversipes were obtained from trap-nests placed in four localities in Sao Paulo, Brazil. The study lasted from March 2007 to February 2009. Out of a total of 650 nests with emergences, 118 were infested with mites (Roubikia sp.). From these nests, 176 individuals of T. diversipes emerged with mites on their bodies. Additionally, six individuals of Coelioxoides waltheriae, the specific kleptoparasitic bee to T. diversipes, emerged. Mites were attached mainly to the mesosoma. All nests infected with mites did not presented mortality of the immature. The mortality rate of nests was inversely related to the level of mite infestation, suggesting a mutualistic interaction in which mites may remove fungi from the nests, while the bees would provide the mites with transport, dispersal, and shelter.

Pollen sources of the orchid bee Euglossa annectans Dressler 1982 (Hymenoptera: Apidae, Euglossini) analyzed from larval provisions

In order to analyze the pollen resources used by the orchid bee Euglossa annectans, samples of larval provisions from cells under construction were taken from 12 different trap nests (wooden boxes) on Santa Catarina Island, southern Brazil. The 43 samples collected between 2002 and 2005 represented all months except December. Overall, 74 pollen types from 24 families were distinguished. Among the 26 pollen types that reached more than 10% in monthly means, the families Melastomataceae, Bromeliaceae, Ochnaceae, Fabaceae, and Myrtaceae were most frequently represented. The Shannon-Weaver diversity index H' for the 43 brood cells varied from 0.10-1.65 and the annual diversity was 0.98. Similarity indices ranged from 0 to 0.87 and were highest during spring and summer. The results characterize E. annectans as a polylectic species. Based on these data, we can conclude that Euglossa females may act as pollinators of many forest species.