952 resultados para Bat fly
Resumo:
We studied the ectoparasitic bat flies of three phyllostomid vampire bat species. Bats were collected monthly from April 2004-March 2005 in caves within the Cafuringa Environmental Protection Area in the Federal District of Brazil. A total of 1,259 specimens from six species in the Streblidae family were collected from 332 bats. High host affinity from the sampled bat fly species and high prevalence of bat flies confirms the primary fly-host associations (Strebla wiedemanni, Trichobius parasiticus and Trichobius furmani with Desmodus, Trichobius diaemi and Strebla diaemi with Diaemus and T. furmani with Diphylla). Male flies outnumbered females in several associations. Some of the observed associations (e.g., Strebla mirabilis with Desmodus and S. mirabilis, Trichobius uniformis and S. wiedemanni with Diphylla) were inconclusive and the causes of the associations were unclear. There are several explanations for these associations, including (i) accidental contamination during sampling, (ii) simultaneous capture of several host species in the same net or (iii) genuine, but rare, ecological associations. Although various species of vampire bats share roosts, have similar feeding habits and are close phylogenetic relatives, they generally do not share ectoparasitic streblid bat flies. T. diaemi and S. diaemi associations with Diaemus youngi have not been previously reported in this region.
Resumo:
We examined whether, like many parasite-host systems of coevolution, a group of obligate parasitic bat flies (Trichobius phyllostomae Kessel and related species) cospeciate with their hosts. We first did a cladistic analysis of the T. phyllostomae group and combined that analysis with a phylogenetic hypothesis from the literature for the Stenodermatinae bats. The cladistic analysis included, as outgroups, one species from each morphological group and complex of Trichobius Gervais, and one species from the following genera: Paratrichobius Miranda-Ribeiro, Megistopoda Macquart, Megistapophysys Dick & Wenzel, Neotrichobius Wenzel & Aitken, Speiseria Kessel and Strebla Wiedemann. The cladogram was rooted with a species of Strebla in the subfamily Streblinae. One cladogram was obtained and which found Trichobius to be polyphyletic. The phylogenetic hypothesis as follows: (Paratrichobius, (Neotrichobius, (Megistopoda, Megistapophysis)))) is the sister-group of the phyllostomae group and the following relationships within the ingroup, (((T. vampyropis Wenzel, Trichobius sp. 2) ((T. hispidus Wenzel, T. petersoni Wenzel) ((Trichobius sp. 1 (T. phyllostomae, T. brennani Wenzel))))). When we compared phylogenies through historical association analyses, cospeciation was uncommon, while host-switching was more common and better explained the association between the phyllostomae group and their bat hosts.
Resumo:
For a better understanding of the complex coevolutionary processes between hosts and parasites, accurate identification of the actors involved in the interaction is of fundamental importance. Blood parasites of the Order Haemosporidia, responsible for malaria, have become the focus of a broad range of studies in evolutionary biology. Interestingly, molecular-based studies on avian malaria have revealed much higher species diversity than previously inferred with morphology. Meanwhile, studies on bat haemosporidian have been largely neglected. In Europe, only one genus (Polychromophilus) and two species have been morphologically described. To evaluate the presence of potential cryptic species and parasite prevalence, we undertook a molecular characterization of Polychromophilus in temperate zone bats. We used a nested-PCR approach on the cytochrome b mitochondrial gene to detect the presence of parasites in 237 bats belonging to four different species and in the dipteran bat fly Nycteribia kolenatii, previously described as being the vector of Polychromophilus. Polychromophilus murinus was found in the four bat species and in the insect vector with prevalence ranging from 4% for Myotis myotis to 51% for M. daubentoni. By sequencing 682 bp, we then investigated the phylogenetic relationships of Polychromophilus to other published malarial lineages. Seven haplotypes were found, all very closely related, suggesting the presence of a single species in our samples. These haplotypes formed a well-defined clade together with Haemosporidia of tropical bats, revealing a worldwide distribution of this parasite mostly neglected by malarial studies since the 1980s.
Resumo:
A catalogue of the family Nycteribiidae (Diptera, Hippoboscoidea) of the New World is presented. Two genera and 52 species are listed in alphabetical order. Each genus account lists synonymies and type species, and each species account lists type locality and host, disposition of type material, geographic and host distribution, and a detailed bibliography.
Resumo:
Parasite population structure is often thought to be largely shaped by that of its host. In the case of a parasite with a complex life cycle, two host species, each with their own patterns of demography and migration, spread the parasite. However, the population structure of the parasite is predicted to resemble only that of the most vagile host species. In this study, we tested this prediction in the context of a vector-transmitted parasite. We sampled the haemosporidian parasite Polychromophilus melanipherus across its European range, together with its bat fly vector Nycteribia schmidlii and its host, the bent-winged bat Miniopterus schreibersii. Based on microsatellite analyses, the wingless vector, and not the bat host, was identified as the least structured population and should therefore be considered the most vagile host. Genetic distance matrices were compared for all three species based on a mitochondrial DNA fragment. Both host and vector populations followed an isolation-by-distance pattern across the Mediterranean, but not the parasite. Mantel tests found no correlation between the parasite and either the host or vector populations. We therefore found no support for our hypothesis; the parasite population structure matched neither vector nor host. Instead, we propose a model where the parasite's gene flow is represented by the added effects of host and vector dispersal patterns.
Resumo:
Laboratory and field experiments have demonstrated in many cases that malaria vectors do not feed randomly, but show important preferences either for infected or non-infected hosts. These preferences are likely in part shaped by the costs imposed by the parasites on both their vertebrate and dipteran hosts. However, the effect of changes in vector behaviour on actual parasite transmission remains a debated issue. We used the natural associations between a malaria-like parasite Polychromophilus murinus, the bat fly Nycteribia kolenatii and a vertebrate host the Daubenton's bat Myotis daubentonii to test the vector's feeding preference based on the host's infection status using two different approaches: 1) controlled behavioural assays in the laboratory where bat flies could choose between a pair of hosts; 2) natural bat fly abundance data from wild-caught bats, serving as an approximation of realised feeding preference of the bat flies. Hosts with the fewest infectious stages of the parasite were most attractive to the bat flies that did switch in the behavioural assay. In line with the hypothesis of costs imposed by parasites on their vectors, bat flies carrying parasites had higher mortality. However, in wild populations, bat flies were found feeding more based on the bat's body condition, rather than its infection level. Though the absolute frequency of host switches performed by the bat flies during the assays was low, in the context of potential parasite transmission they were extremely high. The decreased survival of infected bat flies suggests that the preference for less infected hosts is an adaptive trait. Nonetheless, other ecological processes ultimately determine the vector's biting rate and thus transmission. Inherent vector preferences therefore play only a marginal role in parasite transmission in the field. The ecological processes rather than preferences per se need to be identified for successful epidemiological predictions.
Resumo:
Levantamento das espécies de moscas ectoparasitas de morcego da família Streblidae sobre morcegos da família Phyllostomidae foi realizado na Estação Ecológica de Caetetus, São Paulo. Foram capturados 400 indivíduos de 15 espécies de morcegos filostomídeos, mas somente seis espécies abrigavam 93 indivíduos de nove espécies de Streblidae. A prevalência e intensidade média são apresentadas para cada espécie de Streblidae. Strebla chrotopteri Wenzel, 1976 é registrada pela primeira vez no Estado de São Paulo.
Resumo:
A new species of parthenogenetic, autogenic and apparently extremely endemic phlebotomine is described from a sandstone cave located in primary terra firme forest to the North of the city of Manaus. Specimens were collected in the aphotic zone of the Refúgio do Maruaga cave by light trap and reared from bat guano. The adult morphology suggests a closer relationship to some Old World Phlebotominae than to species of Lutzomyia França encountered in the surrounding rainforest, but it shares characteristics with the recently proposed Neotropical genera Edentomyia Galati, Deanemyia Galati and Oligodontomyia Galati.
Resumo:
Streblidae flies are specialised parasites of bat hosts, mainly phyllostomids. There is a high richness of streblids in the savannah-like Cerrado region; however, there is little quantitative data available in parasitological indices. Here, we describe the component community, prevalence and intensity of a streblid infestation on a phyllostomid bat assemblage in Serra da Bodoquena, a Cerrado region in Southwest Brazil. We conducted surveys by capturing and inspecting bat hosts during the seven-month period between October 2004-December 2005. All the ectoparasites found on the bats were collected in the field and then counted and identified in the laboratory. We captured 327 bats belonging to 13 species, of which eight species were parasitized by 17 species of streblids. Carollia perspicillata and Glossophaga soricina were infested with seven streblid species, whereas the other bat species were infested with four or fewer streblid species. Megistopoda proxima and Aspidoptera falcata flies were found on Sturnira lilium, and Trichobius joblingi was the most prevalent fly on C. perspicillata. Megistopoda aranea and Aspidoptera phyllostomatis were highly prevalent and had a high intensity of infestation on Artibeus planirostris. Overall comparisons of the available data suggest that the component communities of streblids vary more between the Cerrado and Atlantic Forest phytogeographical regions than between localities within the same phytogeographical region.
Resumo:
We investigate the population genetic structure of the Maghrebian bat, Myotis punicus, between the mainland and islands to assess the island colonization pattern and current gene flow between nearby islands and within the mainland. Location North Africa and the Mediterranean islands of Corsica and Sardinia. Methods We sequenced part of the control region (HVII) of 79 bats across 11 colonies. The phylogeographical pattern was assessed by analysing molecular diversity indices, examining differentiation among populations and estimating divergence time. In addition, we genotyped 182 bats across 10 colonies at seven microsatellite loci. We used analysis of molecular variance and a Bayesian approach to infer nuclear population structure. Finally, we estimated sex-specific dispersal between Corsica and Sardinia. Results Mitochondrial analyses indicated that colonies between Corsica, Sardinia and North Africa are highly differentiated. Within islands there was no difference between colonies, while at the continental level Moroccan and Tunisian populations were highly differentiated. Analyses with seven microsatellite loci showed a similar pattern. The sole difference was the lack of nuclear differentiation between populations in North Africa, suggesting a male-biased dispersal over the continental area. The divergence time of Sardinian and Corsican populations was estimated to date back to the early and mid-Pleistocene. Main conclusions Island colonization by the Maghrebian bats seems to have occurred in a stepping-stone manner and certainly pre-dated human colonization. Currently, open water seems to prevent exchange of bats between the two islands, despite their ability to fly and the narrowness of the strait of Bonifacio. Corsican and Sardinian populations are thus currently isolated from any continental gene pool and must therefore be considered as different evolutionarily significant units (ESU).
Resumo:
Devido aos seus hábitos de voar alto e se abrigar em folhas de palmeiras, há poucos registros na literatura sobre o morcego Diclidurus scutatus Peters, 1869. No Brasil, essa espécie é conhecida somente na região Norte e o presente estudo descreve sua primeira ocorrência na região Sudeste. O morcego foi encontrado morto no parapeito da janela de um apartamento do nono andar, em um edifício residencial, na área urbana da cidade de São Paulo, estado de São Paulo. Provavelmente esse morcego devia viver na Serra da Cantareira, um fragmento da mata Atlântica, próximo da cidade de São Paulo.
Resumo:
Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.
Resumo:
On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.