130 resultados para ANASTREPHA


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: In the tephritids Ceratitis, Bactrocera and Anastrepha, the gene transformer provides the memory device for sex determination via its auto-regulation; only in females is functional Tra protein produced. To date, the isolation and characterisation of the gene transformer-2 in the tephritids has only been undertaken in Ceratitis, and it has been shown that its function is required for the female-specific splicing of doublesex and transformer pre-mRNA. It therefore participates in transformer auto-regulatory function. In this work, the characterisation of this gene in eleven tephritid species belonging to the less extensively analysed genus Anastrepha was undertaken in order to throw light on the evolution of transformer-2. Results: The gene transformer-2 produces a protein of 249 amino acids in both sexes, which shows the features of the SR protein family. No significant partially spliced mRNA isoform specific to the male germ line was detected, unlike in Drosophila. It is transcribed in both sexes during development and in adult life, in both the soma and germ line. The injection of Anastrepha transformer-2 dsRNA into Anastrepha embryos caused a change in the splicing pattern of the endogenous transformer and doublesex pre-mRNA of XX females from the female to the male mode. Consequently, these XX females were transformed into pseudomales. The comparison of the eleven Anastrepha Transformer-2 proteins among themselves, and with the Transformer-2 proteins of other insects, suggests the existence of negative selection acting at the protein level to maintain Transformer-2 structural features. Conclusions: These results indicate that transformer-2 is required for sex determination in Anastrepha through its participation in the female-specific splicing of transformer and doublesex pre-mRNAs. It is therefore needed for the auto-regulation of the gene transformer. Thus, the transformer/transfomer-2 > doublesex elements at the bottom of the cascade, and their relationships, probably represent the ancestral state ( which still exists in the Tephritidae, Calliphoridae and Muscidae lineages) of the extant cascade found in the Drosophilidae lineage ( in which tra is just another component of the sex determination gene cascade regulated by Sex-lethal). In the phylogenetic lineage that gave rise to the drosophilids, evolution co-opted for Sex-lethal, modified it, and converted it into the key gene controlling sex determination.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Four new species of Anastrepha Schiner were collected in McPhail-type traps hung in trees in a natural reserve and in commercial papaya orchards in Linhares, Espirito Santo state, Brazil. They are described and named herein as follows: Anastrepha atlantica n. sp., Anastrepha glochin n. sp., Anastrepha linharensis n. sp. and Anastrepha martinsi n. sp. Only the latter was collected in traps hung in papaya orchards. The classification of these species in species groups of Anastrepha is also discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

2016

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Foram coletados 2 630 parasìtóides de Anastrephaspp., pertencentes a cinco espécies de Braconidae, em quatro locais de dois municípios do Estado do Amazonas. Optussp. foi a espécie predominante no estudo, ocorrendo com maior freqüência na área urbana de Manaus. Doryctobracon areolatus(Szépligeti, 1911) foi a espécie predominante nas áreas rurais. As comunidades foram delimitadas e caracterizadas através de índices faunísticos. As comunidades apresentaram quocientes de similaridade entre 82 e 100%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Este trabalho relata a primeira ocorrência de parasitóides em moscas-das-frutas do gênero Anastrepha Schiner no estado do Acre. No município de Bujari foram encontrados os braconídeos Opius bellus Gahan (72,5%), Doryctobracon areolatus (Szépligeti) (26,8%) e Utetes anastrephae (Viereck) (0,7%) associados a A. obliqua (Macquart) em frutos de taperebá (Spondias mombin L.), com parasitismo de 29,5%. No município de Rio Branco, em frutos de goiaba (Psidium guajava L.), ocorreu somente D. areolatus em A. obliqua com parasitismo de 2,7%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835) wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835) females are able to associate a compound (quinine sulphate - QS) not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a diet containing agar and QS. When the nutritional value of the diets was adequate, the females did not show any preference for the diet with or without QS. With respect to the agar diet and the agar + QS diet, females previously fed on a nutritive diet containing QS preferred the diet containing QS, indicating an association between the compound and the nutritional value of the diet. The importance of this behavioral strategy is discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A mosca-das-frutas-sul-americana, Anastrepha fraterculus (Wiedemann, 1830), é uma das principais pragas da fruticultura no Brasil. Durante a alimentação, as larvas fazem galerias nos frutos, alterando o sabor e prejudicando a produção e comercialização dos mesmos. O presente trabalho teve como objetivo estudar fatores envolvidos na escolha do hospedeiro por A. fraterculus. Foram avaliadas as respostas eletroantenográficas de machos e fêmeas a extratos etanólicos de frutos verdes e maduros de pessegueiro - Prunus persica, cultivar Chimarrita (Rosaceae), pitangueira - Eugenia uniflora (Myrtaceae), guabirobeira - Campomanesia xanthocarpa (Myrtaceae) e araçazeiro - Psidium cattleianum (Myrtaceae). Foram também observadas as influências da cor (amarela, verde e vermelha) e da composição do substrato de oviposição (polpas de araçá, guabiroba, pitanga e pêssego) na fecundidade da espécie. As respostas eletroantenográficas de fêmeas foram significativamente distintas para os extratos de guabiroba verde e madura, araçá maduro e pitanga verde. Em antenas de machos, as maiores despolarizações médias foram registradas em resposta aos extratos de guabiroba verde e madura, araçá verde e maduro e pitanga verde. As respostas eletrofisiológicas geradas não diferiram estatisticamente entre os sexos, para todos os tratamentos. A cor do substrato não afetou a oviposição. As fêmeas ovipositaram mais nos substratos contendo polpa de pêssego e de guabiroba, quando comparados aos respectivos controles.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Moscas das frutas do gênero Anastrepha Schiner, 1868 são conhecidas por sua importância econômica devido aos danos que elas causam nos frutos comerciais. As exigências nutricionais dos estágios imaturo e adulto são diferentes e as larvas não se desenvolvem bem utilizando a mesma dieta do adulto. Embora as necessidades nutricionais básicas dos insetos sejam bem conhecidas, existe ainda o problema de elaborar dietas de criação adequadas para espécies com necessidades específicas. O objetivo deste trabalho foi verificar o efeito de diferentes tipos e quantidades de carboidratos na dieta sobre a performance larval de Anastrepha obliqua (Macquart, 1835). Larvas foram criadas individualmente em tubos de ensaio contendo uma das dietas artificiais a serem testadas onde elas foram mantidas até a pupação. A composição básica das dietas testadas incluia 2,5 g de agar, 3,25 g de levedo de cerveja e quantidades variadas de sacarose e farinha de trigo. A adequação do meio artificial para A. obliqua foi testada pela avaliação da sobrevivência larval e pupal (%) e o tempo de desenvolvimento larval, pupal e de larva-adulto. A dieta contendo farinha de trigo (2 g) e sacarose (2 g) e a dieta somente com sacarose (5,5 g) foram as que apresentaram melhor performance larval. Todas as dietas testadas apresentaram resultados similares ou superiores às dietas utilizadas em outros trabalhos. A importância da presença da farinha de trigo e seu valor nutricional para as larvas são discutidos.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The South American fruit fly, Anastrepha fraterculus (Wiedemann, 1830) (Diptera, Tephritidae), is a leading pest of Brazilian fruit crops. This study evaluated how prior experience with artificial fruits containing peach and/or guabiroba pulp influenced the ovipositing behavior of A. fraterculus. Insects 15-21 days old were exposed to four treatments: 1) experience with guabiroba, Campomanesia xanthocarpa O. Berg (Myrtaceae); 2) experience with peach, Prunus persica (L.) Batsch (Chimarrita cultivar; Rosaceae); 3) experience with both fruits; and 4) no experience (naive). Naive females and females experienced with guabiroba pulp and with both fruits (peach and guabiroba) oviposited and showed dragging and puncturing behavior on substrates containing guabiroba, but females that were only exposed to peach pulp did not show a preference for any substrate. The study shows that prior experience with substrate influences ovipositing behavior in A. fraterculus.