Monitoring of New Psychoactive Substances in the hair of patients with a history of addiction. Evaluation of the public health impact.

Introduction. The term New Psychoactive Substances (NPS) encompasses a broad category of drugs which have become available on the market in recent years and whose illicit use for recreational purposes has recently exploded. The analysis of NPS usually requires mass spectrometry based techniques. The aim of our study was to define the preva-lence of NPS consumption in patients with a history of drug addiction followed by Public Services for Pathological Addictions, with the purpose of highlighting the effective presence of NPS within the area of Bologna and evaluating their association with classical drugs of abuse (DOA). Materials and methods. Sustained by literature, a multi-analyte UHPLC-MS/MS method for the identification of 127 NPS (phenethylamines, arylcyclohexylamines, synthetic opioids, tryptamines, synthetic cannabinoids, synthetic cathinones, designer benzodiazepines) and 15 classic drugs of abuse (DOA) in hair samples was developed and validated according to International Guidelines [112]. Samples pretreatment consisted of washing steps and overnight incubation at 45°C in an acid mixture of methanol and water. After cooling, supernatant were injected into the chromatographic system coupled with a tandem mass spectrometry detector. Results. Successful validation was achieved for almost all of the compounds. The method met all the required technical parameters. LOQ was set from 4 to 80 pg/mg The developed method was applied to 107 cases (85 males and 22 females) of clinical interest. Out of 85 hair samples resulting positive to classical drugs of abuse, NPS were found in twelve (8 male and 4 female). Conclusion. The present methodology represents an easy, low cost, wide-panel method for the de-tection of 127 NPS and 15 DOA in hair samples. Such multi-analyte methods facilitates the study of the prevalence of drugs abused that will enable the competent control authorities to obtain evi-dence-based reports regarding the critical spread of the threat represented by NPS.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Monitoramento de parâmetros imunológicos em atletas adolescentes de basquetebol durante e após a temporada esportiva= : Monitoring of immunological parameters in adolescent basketball athletes during and after a sports season

Universidade Estadual de Campinas . Faculdade de Educação Física

Pitfalls of artificial grouping and stratification of scientific journals based on their Impact Factor: a case study in Brazilian Zoology

The present contribution explores the impact of the QUALIS metric system for academic evaluation implemented by CAPES (Coordination for the Development of Personnel in Higher Education) upon Brazilian Zoological research. The QUALIS system is based on the grouping and ranking of scientific journals according to their Impact Factor (IF). We examined two main points implied by this system, namely: 1) its reliability as a guideline for authors; 2) if Zoology possesses the same publication profile as Botany and Oceanography, three fields of knowledge grouped by CAPES under the subarea "BOZ" for purposes of evaluation. Additionally, we tested CAPES' recent suggestion that the area of Ecology would represent a fourth field of research compatible with the former three. Our results indicate that this system of classification is inappropriate as a guideline for publication improvement, with approximately one third of the journals changing their strata between years. We also demonstrate that the citation profile of Zoology is distinct from those of Botany and Oceanography. Finally, we show that Ecology shows an IF that is significantly different from those of Botany, Oceanography, and Zoology, and that grouping these fields together would be particularly detrimental to Zoology. We conclude that the use of only one parameter of analysis for the stratification of journals, i.e., the Impact Factor calculated for a comparatively small number of journals, fails to evaluate with accuracy the pattern of publication present in Zoology, Botany, and Oceanography. While such simplified procedure might appeals to our sense of objectivity, it dismisses any real attempt to evaluate with clarity the merit embedded in at least three very distinct aspects of scientific practice, namely: productivity, quality, and specificity.

A feasibility study of cell phone and landline phone interviews for monitoring of risk and protection factors for chronic diseases in Brazil

The study objective was to evaluate the feasibility of interviews by cell phone as a complement to interviews by landline to estimate risk and protection factors for chronic non-communicable diseases. Adult cell phone users were evaluated by random digit dialing. Questions asked were: age, sex, education, race, marital status, ownership of landline and cell phones, health condition, weight and height, medical diagnosis of hypertension and diabetes, physical activity, diet, binge drinking and smoking. The estimates were calculated using post-stratification weights. The cell phone interview system showed a reduced capacity to reach elderly and low educated populations. The estimates of the risk and protection factors for chronic non-communicable diseases in cell phone interviews were equal to the estimates obtained by landline phone. Eligibility, success and refusal rates using the cell phone system were lower than those of the landline system, but loss and cost were much higher, suggesting it is unsatisfactory as a complementary method in such a context.

The variability and predictors of quality of AIDS care services in Brazil

Background: Since establishing universal free access to antiretroviral therapy in 1996, the Brazilian Health System has increased the number of centers providing HIV/AIDS outpatient care from 33 to 540. There had been no formal monitoring of the quality of these services until a survey of 336 AIDS health centers across 7 Brazilian states was undertaken in 2002. Managers of the services were asked to assess their clinics according to parameters of service inputs and service delivery processes. This report analyzes the survey results and identifies predictors of the overall quality of service delivery. Methods: The survey involved completion of a multiple-choice questionnaire comprising 107 parameters of service inputs and processes of delivering care, with responses assessed according to their likely impact on service quality using a 3-point scale. K-means clustering was used to group these services according to their scored responses. Logistic regression analysis was performed to identify predictors of high service quality. Results: The questionnaire was completed by 95.8% (322) of the managers of the sites surveyed. Most sites scored about 50% of the benchmark expectation. K-means clustering analysis identified four quality levels within which services could be grouped: 76 services (24%) were classed as level 1 (best), 53 (16%) as level 2 (medium), 113 (35%) as level 3 (poor), and 80 (25%) as level 4 (very poor). Parameters of service delivery processes were more important than those relating to service inputs for determining the quality classification. Predictors of quality services included larger care sites, specialization for HIV/AIDS, and location within large municipalities. Conclusion: The survey demonstrated highly variable levels of HIV/AIDS service quality across the sites. Many sites were found to have deficiencies in the processes of service delivery processes that could benefit from quality improvement initiatives. These findings could have implications for how HIV/AIDS services are planned in Brazil to achieve quality standards, such as for where service sites should be located, their size and staffing requirements. A set of service delivery indicators has been identified that could be used for routine monitoring of HIV/AIDS service delivery for HIV/AIDS in Brazil (and potentially in other similar settings).

A systematic review with procedural assessments and meta-analysis of Low Level Laser Therapy in lateral elbow tendinopathy (tennis elbow)

Background: Recent reviews have indicated that low level level laser therapy (LLLT) is ineffective in lateral elbow tendinopathy (LET) without assessing validity of treatment procedures and doses or the influence of prior steroid injections. Methods: Systematic review with meta-analysis, with primary outcome measures of pain relief and/or global improvement and subgroup analyses of methodological quality, wavelengths and treatment procedures. Results: 18 randomised placebo-controlled trials (RCTs) were identified with 13 RCTs (730 patients) meeting the criteria for meta-analysis. 12 RCTs satisfied half or more of the methodological criteria. Publication bias was detected by Egger's graphical test, which showed a negative direction of bias. Ten of the trials included patients with poor prognosis caused by failed steroid injections or other treatment failures, or long symptom duration or severe baseline pain. The weighted mean difference (WMD) for pain relief was 10.2 mm [95% CI: 3.0 to 17.5] and the RR for global improvement was 1.36 [1.16 to 1.60]. Trials which targeted acupuncture points reported negative results, as did trials with wavelengths 820, 830 and 1064 nm. In a subgroup of five trials with 904 nm lasers and one trial with 632 nm wavelength where the lateral elbow tendon insertions were directly irradiated, WMD for pain relief was 17.2 mm [95% CI: 8.5 to 25.9] and 14.0 mm [95% CI: 7.4 to 20.6] respectively, while RR for global pain improvement was only reported for 904 nm at 1.53 [95% CI: 1.28 to 1.83]. LLLT doses in this subgroup ranged between 0.5 and 7.2 Joules. Secondary outcome measures of painfree grip strength, pain pressure threshold, sick leave and follow-up data from 3 to 8 weeks after the end of treatment, showed consistently significant results in favour of the same LLLT subgroup (p < 0.02). No serious side-effects were reported. Conclusion: LLLT administered with optimal doses of 904 nm and possibly 632 nm wavelengths directly to the lateral elbow tendon insertions, seem to offer short-term pain relief and less disability in LET, both alone and in conjunction with an exercise regimen. This finding contradicts the conclusions of previous reviews which failed to assess treatment procedures, wavelengths and optimal doses.

Colonization and extinction of land planarians (Platyhelminthes, Tricladida) in a Brazilian Atlantic Forest regrowth remnant

Long-term assessments of species assemblages are valuable tools for detecting species ecological preferences and their dispersal tracks, as well as for assessing the possible effects of alien species on native communities. Here we report a 50-year-long study on population dynamics of the four species of land flatworms (Platyhelminthes, Tricladida, Terricola) that have colonized or become extinct in a 70-year-old Atlantic Forest regrowth remnant through the period 1955-2006. On the one hand, the two initially most abundant species, which are native to the study site, Notogynaphallia ernesti and Geoplana multicolor have declined over decades and at present do not exist in the forest remnant. The extinction of these species is most likely related with their preference for open vegetation areas, which presently do not exist in the forest remnant. On the other hand, the neotropical Geoplaninae 1 and the exotic Endeavouria septemlineata were detected in the forest only very recently. The long-term study allowed us to conclude that Geoplaninae 1 was introduced into the study area, although it is only known from the study site. Endeavouria septemlineata, an active predator of the exotic giant African snail, is originally known from Hawaii. This land flatworm species was observed repeatedly in Brazilian anthropogenic areas, and this is the first report of the species in relatively well preserved native forest, which may be evidence of an ongoing adaptive process. Monitoring of its geographic spread and its ecological role would be a good practice for preventing potential damaging effects, since it also feeds on native mollusk fauna, as we observed in lab conditions.

Monitoring stress tolerance and occurrences of upper respiratory illness in basketball players by means of psychometric tools and salivary biomarkers

The aim of the study was to evaluate the possible relationships between stress tolerance, training load, banal infections and salivary parameters during 4 weeks of regular training in fifteen basketball players. The Daily Analysis of Life Demands for Athletes` questionnaire (sources and symptoms of stress) and the Wisconsin Upper Respiratory Symptom Survey were used on a weekly basis. Salivary cortisol and salivary immunoglobulin A (SIgA) were collected at the beginning (before) and after the study, and measured by enzyme-linked immunosorbent assay (ELISA). Ratings of perceived exertion (training load) were also obtained. The results from ANOVA with repeated measures showed greater training loads, number of upper respiratory tract infection episodes and negative sensation to both symptoms and sources of stress, at week 2 (p < 0.05). Significant increases in cortisol levels and decreases in SIgA secretion rate were noted (before to after). Negative sensations to symptoms of stress at week 4 were inversely and significantly correlated with SIgA secretion rate. A positive and significant relationship between sources and symptoms of stress at week 4 and cortisol levels were verified. In summary, an approach incorporating in conjunction psychometric tools and salivary biomarkers could be an efficient means of monitoring reaction to stress in sport. Copyright (C) 2010 John Wiley & Sons, Ltd.

Reliability and validity of the Impact of Event Scale (IES): version for Brazilian burn victims

Aims. The aims of this study were to assess the internal reliability (internal consistency), construct validity, sensitivity and ceiling and floor effects of the Brazilian-Portuguese version of the Impact of Event Scale (IES). Design. Methodological research design. Method. The Brazilian-Portuguese version of the IES was applied to a group of 91 burned patients at three times: the first week after the burn injury (time one), between the fourth and the sixth months (time two) and between the ninth and the 12th months (time three). The internal consistency, construct validity (convergent and dimensionality), sensitivity and ceiling and floor effects were tested. Results. Cronbach`s alpha coefficients showed high internal consistency for the total scale (0 center dot 87) and for the domains intrusive thoughts (0 center dot 87) and avoidance responses (0 center dot 76). During the hospitalisation (time one), the scale showed low and positive correlations with pain measures immediately before (r = 0 center dot 22; p < 0 center dot 05) and immediately after baths and dressings (r = 0 center dot 21; p < 0 center dot 05). After the discharge, we found strong and negative correlations with self-esteem (r = -0 center dot 52; p < 0 center dot 01), strong and positive with depression (r = 0 center dot 63; p < 0 center dot 01) and low and negative with the Bodily pain (r = -0 center dot 24; p < 0 center dot 05), Social functioning (r = -0 center dot 34; p < 0 center dot 01) and Mental health (r = -0 center dot 27; p < 0 center dot 05) domains of the SF-36 at time two. Regarding the sensitivity, no statistically significant differences were observed between mean scale scores according to burned body surface (p = 0 center dot 21). The floor effect was observed in most of the IES items. Conclusion. The adapted version of the scale showed to be reliable and valid to assess postburn reactions on the impact of the event in the group of patients under analysis. Relevance to clinical practice. The Impact of Event Scale can be used in research and clinical practice to assess nursing interventions aimed at decreasing stress during rehabilitation.

Impact of transition oxides on growth stresses and texture of alumina scales formed during oxidation of iron aluminides

The internal stresses and crystallographic texture in alpha-Al(2)O(3) scales grown on iron aluminides at 1100 degrees C were determined in situ using synchrotron X-ray diffraction. In the first hour of oxidation, alpha-Al(2)O(3) was formed by direct nucleation and by conversion from transition oxides (either theta-Al(2)O(3) or a mixed Fe-Al oxide). A sharp texture develops connected with the direct nucleation of alpha-Al(2)O(3), in contrast to the weaker texture observed in alpha-Al(2)O(3) originated by previous transformations, which also yielded tensile stresses in early oxidation stages. (C) 2011 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Timing and Dose of Statin Therapy Define Its Impact on Inflammatory and Endothelial Responses During Myocardial Infarction

Objective-Clinical trials of statins during myocardial infarction (MI) have differed in their therapeutic regimes and generated conflicting results. This study evaluated the role of the timing and potency of statin therapy on its potential mechanisms of benefit during MI. Methods and Results-ST-elevation MI patients (n = 125) were allocated into 5 groups: no statin; 20, 40, or 80 mg/day simvastatin starting at admission; or 80 mg/day simvastatin 48 hours after admission. After 7 days, all patients switched their treatment to 20 mg/day simvastatin for an additional 3 weeks and then underwent flow-mediated dilation in the brachial artery. As of the second day, C-reactive protein (CRP) differed between non-statin users (12.0 +/- 4.1 mg/L) and patients treated with 20 (8.5 +/- 4.0 mg/L), 40 (3.8 +/- 2.5 mg/L), and 80 mg/day (1.4 +/- 1.5 mg/L), and the daily differences remained significant until the seventh day (P < 0.0001). The higher the statin dose, the lower the elevation of interleukin-2 and tumor necrosis factor-alpha, the greater the reduction of 8-isoprostane and low-density lipoprotein(-), and the greater the increase in nitrate/nitrite levels during the first 5 days (P < 0.001). Later initiation of statin was less effective than its early introduction in relation to attenuation of CRP, interleukin-2, tumor necrosis factor-alpha, 8-isoprostane, and low-density lipoprotein(-), as well as in increase in nitrate/nitrite levels (P < 0.0001). At the 30th day, there was no longer a difference in lipid profile or CRP between groups; the flow-mediated dilation, however, was proportional to the initial statin dose and was higher for those who started the treatment early (P = 0.001). Conclusion-This study demonstrates that the timing and potency of statin treatment during MI are key elements for their main mechanisms of benefit.

An initial assessment of policies for saving a rare Australian glider: Experimental results, economics and ecology

Reviews the ecological status of the mahogany glider and describes its distribution, habitat and abundance, life history and threats to it. Three serial surveys of Brisbane residents provide data on the knowledge of respondents about the mahogany glider. The results provide information about the attitudes of respondents to the mahogany glider, to its conservation and relevant public policies and about variations in these factors as the knowledge of participants of the mahogany glider alters. Similarly data is provided and analysed about the willingness to pay of respondents to conserve the mahogany glider. Population viability analysis is applied to estimate the required habitat area for a minimum viable population of the mahogany glider to ensure at least a 95% probability of its survival for 100 years. Places are identified in Queensland where the requisite minimum area of critical habitat can be conserved. Using the survey results as a basis, the likely willingness of groups of Australians to pay for the conservation of the mahogany glider is estimated and consequently their willingness to pay for the minimum required area of its habitat. Methods for estimating the cost of protecting this habitat are outlined. Australia-wide benefits seem to exceed the costs. Establishing a national park containing the minimum viable population of the mahogany glider is an appealing management option. This would also be beneficial in conserving other endangered wildlife species. Therefore, additional economic benefits to those estimated on account of the mahogany glider itself can be obtained.

A H-1 MRS study of probable Alzheimer's disease and normal aging: Implications for longitudinal monitoring of dementia progression

In order to evaluate the capability of H-1 MRS to monitor longitudinal changes in subjects with probable Alzheimer's disease (AD), the temporal stability of the metabolite measures N-acetylaspartate and N-acetylas-partylglutamate (NA), total Creatine (Cr), myo-Inositol (mI), total Choline (Chol), NA/Cr, mI/Cr, Chol/Cr and NA/mI were investigated in a cohort of normal older adults. Only the metabolite measures NA, mi, Cr, NA/Cr, mI/Cr, and NA/mI were found to be stable after a mean interval of 260 days. Relative and absolute metabolite measures from a cohort of patients with probable AD were subsequently compared with data from a sample of normal older adult control subjects, and correlated with mental status and the degree of atrophy in the localized voxel. Concentrations of NA, NA/Cr, and NA/mI were significantly reduced in the AD group with concomitant significant increases in mi and mI/Cr. There were no differences between the two groups in measures of Cr, Chol, or Chol/Cr. Significant correlations between mental status as measured by the Mini-Mental State Examination and NA/mI, mI/Cr and NA were found. These metabolite measures were also significantly correlated with the extent of atrophy (as measured by CSF and GM composition) in the spectroscopy voxel. (C) 1999 Elsevier Science Inc.