The unique: or biography of many distinguished characters: with fine portraits.

Binding deteriorated. Foxing. Water. Untrimmed.

Kitāb al-lmdād bi-Maʻrifat ʻUlū al-ʾIsnād /

Mode of access: Internet.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Description of the pupal case of Systropus (Systropus) nitidus Wiedemann, 1830 (Diptera, Bombyliidae, Toxophorinae, Systropodini)

The pupal case of Systropus (Systropus) nitidus Wiedemann reared from an unidentified tipical Limacodidae (Lepidoptera) cocoon is described and illustrated for the first time. Only species of Limacodidae are recorded as host of the immature stages of S. (Systropus). The geographical distribution of S. (Systropus) nitidus is restricted to Brazil, from Pará to Santa Catarina states. This is the first pupal case description and illustration of a Neotropical species of the subgenus Systropus.

Cytogenetic analysis of Astylus antis (Perty, 1830) (Coleoptera, Melyridae): Karyotype, heterochromatin and location of ribosomal genes

Cytogenetic analysis of Astylus antis using mitotic and meiotic cells was performed to characterize the haploid and diploid numbers, sex determination system, chromosome morphology, constitutive heterochromatin distribution pattern and chromosomes carrying nucleolus organizer regions (NORs). Analysis of spermatogonial metaphase cells revealed the diploid number 2n = 18, with mostly metacentric chromosomes. Metaphase I cells exhibited 2n = 8II+Xyp and a parachute configuration of the sex chromosomes. Spermatogonial metaphase cells submitted to C-banding showed the presence of small dots of constitutive heterochromatin in the centromeric regions of nearly all the autosomes and on the short arm of the X chromosome (Xp), as well as an additional band on one of the arms of pair 1. Mitotic cells submitted to double staining with base-specific fluorochromes (DAPI-CMA3) revealed no regions rich in A+T or G+C sequences. Analysis of spermatogonial mitotic cells after sequential Giemsa/AgNO3 staining did not reveal any specific mark on the chromosomes. Meiotic metaphase I cells stained with silver nitrate revealed a strong impregnation associated to the sex chromosomes, and in situ hybridization with an 18S rDNA probe showed ribosomal cistrons in an autosomal bivalent.

"Cheap and nasty": German goods, socialism, and the 1876 Philadelphia world fair

At the World Fair in Philadelphia in 1876, the German goods on display were described as cheap and nasty, setting off a vigorous debate about the state of German industry. Social democrats attacked policies of increasing competitiveness of German exports through keeping wages low, and claimed that the quality of the goods produced by socialist workers was higher than those produced by others. An analysis of the debate shows the extent to which social democrats not only resorted to arguments stressing the national interest, but also the extent to which nominally Marxist socialists in this period were still attached to traditional artisanal values of pride in the quality of their work.

AQUILINO RIBEIRO AND THE MODERNISTS - PORTRAITS OF THE FIRST PORTUGUESE REPUBLIC

Portuguese version:

Uma política de desbaste para a biblioteca do ICS/UL

Relatório de Estágio apresentado para cumprimento dos requisitos necessários à obtenção do grau de Mestre em Ciências da Informação e da Documentação – Área de Especialização em Biblioteconomia

Infecção experimental de Calomys callosus (Rengger, 1830), (Cricetidae - Rodentia) a quatro espécies de parasitos

Neste trabalho foram estudados exemplares do roedor, Calomys callosus, nascidos em laboratório, a infecções experimentais com quatro parasitos: Plasmodium berghei, Leishmania mexicana amazonensis, Schistosoma mansoni e Hymenolepsis nana. A positividade das infecções foi de 80% para os três primeiros parasitos e 0 para H. nana. C. callosus é um roedor de excelente adaptação em laboratório e de fácil manuseio. Acredita-se que, de acordo com os resultados obtidos neste trabalho, este animal poderia ser um bom modelo experimental de laboratório para certos agentes patogênicos.

Desigualdades sociais no trajecto académico e na inserção profissional: o caso dos licenciados na UL/UNL

Dissertação apresentada para cumprimento dos requisitos necessários à obtenção do grau de Mestre em Sociologia

Tityus stigmurus (Thorell, 1876) (Scorpiones; Buthidae): response to chemical control and understanding of scorpionism among the population

In this study, the events following application of the insecticideDemand 2.5 concentrated solution (CS) in the field, to control Tityus stigmurus, were investigated. Data on attitudes and practices relating to scorpionism were collected using a questionnaire. During the months of May to July 2005, 69 premises were monitored on different days following insecticide treatment, focusing on scorpion frequency and mortality. According to the results, 42% of the premises showed scorpion incidence, with an average of three specimens per house. The highest incidence was recorded during the first week following the treatment. Only 7% of the specimens were found dead. Most (72%) of the population showed knowledge about prevention and control measures. Despite this, 100% of the premises presented breeding sites, mainly in debris (79.7%). These results indicate that the scorpion control method used by health agents during this investigation was not efficient, and the results suggest that the method may have had a dispersive effect on these animals.

Visões da psiquiatria, doença mental e república no trabalho do Psiquiatra Luís Cebola (1876-1967): uma abordagem histórica nas encruzilhadas da psiquiatria, ideologia política e ficção, em Portugal, na primeira metade do Século XX

A presente dissertação tem como objectivo a elaboração de uma biografia do psiquiatra Luís Cebola, com ênfase na sua concepção da prática clínica e no seu posicionamento ideológico. Além disso, pretende-se ampliar a compreensão acerca da conceptualização da doença mental, bem como dos tratamentos psiquiátricos aplicados em Portugal, durante a primeira metade do século XX, tendo por base o seu desempenho enquanto director clínico – desde 1911 até 1949 – da Casa de Saúde do Telhal (CST), pertencente à Ordem Hospitaleira de São João de Deus (OHSJD). Esta dissertação representa um estudo pioneiro sobre esta personalidade – negligenciada pela história da psiquiatra praticada até agora em Portugal – e sobre as suas contribuições para o desenvolvimento da psiquiatria portuguesa, bem como para a disseminação-popularização de temas médicos e científicos. Demonstra-se que os tratamentos aplicados na CST, sob a sua direcção clínica, se mantiveram actualizados, tanto em relação aos outros hospitais psiquiátricos portugueses como em relação às instituições estrangeiras. As viagens que Cebola realizou a hospitais psiquiátricos de diversos países europeus, muito contribuíram para a modernização do ambiente hospitalar e terapêutico da CST, bem como para o seu privilegiar da terapia ocupacional – a ergoterapia – enquanto método de tratamento. Conclui-se que o esquecimento do médico por parte dos seus colegas de profissão, bem como pelos estudos históricos da disciplina, se deverá principalmente a três factores: em primeiro lugar, Cebola não desenvolveu projectos de investigação, e, por conseguinte manteve-se afastado das publicações da especialidade, bem como dos debates científicos da época; em segundo lugar, não formou discípulos, não dando, desse modo, continuidade à sua visão da prática clínica; e por último, as suas publicações de crítica sociopolítica, censurando o regime do Estado Novo, a Igreja Católica, e a psicocirurgia, criaram plausivelmente uma relação de tensão com os Irmãos da OHSJD e com a nova geração de psiquiatras.

Owner portraits and heraldry in the "Lamoignon Hours"

Because of the distance in time and the lack of testifying documents, one should be extremely careful when labelling portraits in medieval books of hours as donor portraits or owner portraits. There are, however, manuscripts that reveal their first owner within their decorative programme, and the Lamoignon Hours (Lisbon, Gulbenkian, ms LA 237) is one of these. This article aims to discuss the iconography of the three portraits found on f.165v, f.202v and f.286v, as well as the relevance of portraiture and heraldic insignia in books of hours and the significance of such content to the original owner and to those who possessed the book afterwards.