981 resultados para Latva-Äijö, Annika: Lotta Svärdin synty


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pt. 1: B. Grassi.--pt. 2: M. Sella.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mode of access: Internet.

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

L’objectif de ce mémoire est de faire une étude comparative de la traduction suédoise Le Ventre de l’Atlantique par Lotta Riad avec le texte source à la lumière des douze tendances déformantes d’Antoine Berman. Nous nous efforçons également de présenter « notre traduction » illustrant la méthode bermanienne. Force est de constater, qu’elle n’est pas toujours réalisable, néanmoins, cette démarche permet une réflexion stimulant la clairvoyance.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Tämän kandidaatintyön tavoittena on perehtyä ympäristökeskustelun elinkaarimalliin ja selvittää sen paikkansapitävyys Pariisin ilmastokokouksen aikaisessa Twitter-keskustelussa. Työssä analysoidaan myös keskustelun tunnelmia, ja selvitetään millainen yleinen mielipide Twitterissä vaikutti Pariisin kokouksen aikana. Menetelminä työssä käytetään laadullista tutkimusta ja sisällönanalyysiä. Ympäristökeskustelun elinkaari koostuu viidestä vaiheesta, joita ovat latenssi, synty, kasvu, kypsyys ja taantuma. Vaiheet eroavat toisistaan keskustelun intensiteetin ja keskustelijoiden taustan perusteella. Aineiston perusteella Twitter-keskustelusta erottuu selkeästi elinkaaren vaiheet niin intensiteetin, kuin keskustelijoiden taustojen puolesta. Kerätystä aineistosta erottuu erilaisia tunnelmia, jotka jaetaan seuraavasti: odottava, innokas, epäilevä ja neutraali. Suurin osa tviiteistä kuuluu neutraaliin ryhmään, mikä selittyy Twitterin luonteella ja elinkaaren vaikutuksella. Tunnelmat vaihtelevat keskustelun elinkaaren aikana siten, että alkuun keskustelu on neutraalia, sitten odottavaa ja innokasta, lopuksi epäilevää ja jälleen neutraalia. Työn tulokset kertovat, että elinkaarimallia voidaan soveltaa myös sosiaalisen median keskusteluun. Jatkotutkimuksissa voidaan keskittyä teemojen määrälliseen tutkimukseen.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Ofloxacin is an antimicrobial agent frequently found in significant concentrations in wastewater and surface water. Its continuous introduction into the environment is a potential risk to non-target organisms or to human health. In this study, ofloxacin degradation by UV/TiO2 and UV/TiO2/H2O2, antimicrobial activity (E. coli) of samples subjected to these processes, and by-products formed were evaluated. For UV/TiO2, the degradation efficiency was 89.3% in 60 min of reaction when 128 mg L(-1) TiO2 were used. The addition of 1.68 mmol L(-1) hydrogen peroxide increased degradation to 97.8%. For UV/TiO2, increasing the catalyst concentration from 4 to 128 mg L(-1) led to an increase in degradation efficiency. For both processes, the antimicrobial activity was considerably reduced throughout the reaction time. The structures of two by-products are presented: m/z 291 (9-fluoro-3-methyl-10-(methyleneamino)-7-oxo-2,3-dihydro-7H-[1,4]oxazino[2,3,4-ij]quinoline-6-carboxylic acid) and m/z 157 ((Z)-2-formyl-3-((2-oxoethyl)imino)propanoic acid).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The model of the position-dependent noncommutativity in quantum mechanics is proposed. We start with given commutation relations between the operators of coordinates [(x) over cap (i), (x) over cap (j)] = omega(ij) ((x) over cap), and construct the complete algebra of commutation relations, including the operators of momenta. The constructed algebra is a deformation of a standard Heisenberg algebra and obeys the Jacobi identity. The key point of our construction is a proposed first-order Lagrangian, which after quantization reproduces the desired commutation relations. Also we study the possibility to localize the noncommutativity.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We derive analytical solutions for the three-dimensional time-dependent buckling of a non-Newtonian viscous plate in a less viscous medium. For the plate we assume a power-law rheology. The principal, axes of the stretching D-ij in the homogeneously deformed ground state are parallel and orthogonal to the bounding surfaces of the plate in the flat state. In the model formulation the action of the less viscous medium is replaced by equivalent reaction forces. The reaction forces are assumed to be parallel to the normal vector of the deformed plate surfaces. As a consequence, the buckling process is driven by the differences between the in-plane stresses and out of plane stress, and not by the in-plane stresses alone as assumed in previous models. The governing differential equation is essentially an orthotropic plate equation for rate dependent material, under biaxial pre-stress, supported by a viscous medium. The differential problem is solved by means of Fourier transformation and largest growth coefficients and corresponding wavenumbers are evaluated. We discuss in detail fold evolutions for isotropic in-plane stretching (D-11 = D-22), uniaxial plane straining (D-22 = 0) and in-plane flattening (D-11 = -2D(22)). Three-dimensional plots illustrate the stages of fold evolution for random initial perturbations or initial embryonic folds with axes non-parallel to the maximum compression axis. For all situations, one dominant set of folds develops normal to D-11, although the dominant wavelength differs from the Biot dominant wavelength except when the plate has a purely Newtonian viscosity. However, in the direction parallel to D-22, there exist infinitely many modes in the vicinity of the dominant wavelength which grow only marginally slower than the one corresponding to the dominant wavelength. This means that, except for very special initial conditions, the appearance of a three-dimensional fold will always be governed by at least two wavelengths. The wavelength in the direction parallel to D-11 is the dominant wavelength, and the wavelength(s) in the direction parallel to D-22 is determined essentially by the statistics of the initial state. A comparable sensitivity to the initial geometry does not exist in the classic two-dimensional folding models. In conformity with tradition we have applied Kirchhoff's hypothesis to constrain the cross-sectional rotations of the plate. We investigate the validity of this hypothesis within the framework of Reissner's plate theory. We also include a discussion of the effects of adding elasticity into the constitutive relations and show that there exist critical ratios of the relaxation times of the plate and the embedding medium for which two dominant wavelengths develop, one at ca. 2.5 of the classical Biot dominant wavelength and the other at ca. 0.45 of this wavelength. We propose that herein lies the origin of parasitic folds well known in natural examples.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Motor vehicle crashes are the leading cause of injury death for international tourists. This makes road safety an important issue for tourism authorities. Unfortunately, as it is in other areas of tourist health, the common response from the travel and tourism industry is to remain silent about this problem and to leave any mishaps in the hands of insurers. At the same time, but for different reasons, international tourists are not usually targeted for road safety initiatives by transport authorities. Given that there are considerable 'hidden' costs associated with international tourists and motor vehicle crashes, the topic should be of concern to both tourism and transport groups. This paper examines issues concerned with driving in unfamiliar surroundings for international visitors in Australia, and proposes a national research and management programme to guide policy and planning in the area. (C) 1999 Elsevier Science Ltd. All rights reserved.