The effects of gramicidin on the structure of phospholipid assemblies /

Gramicidin is an antibiotic peptide that can be incorporated into the monolayers of cell membranes. Dimerization through hydrogen bonding between gramicidin monomers in opposing leaflets of the membrane results in the formation of an iontophoretic channel. Surrounding phospholipids, with various associated mechanical properties, have been shown to influence the gating properties of this channel. Conversely, gramicidin incorporation has been shown to affect the structure of spontaneously formed lipid assemblies. Using small-angle x-ray diffraction and model systems composed of phospholipids and gramicidin, the physical effects incurred by gramicidin incorporation were measured. The reverse hexagonal (H^) phase composed of dioleoylphosphatidylethanolamine (DOPE) monolayers decreased in lattice dimension with increasing incorporation of gramicidin. This indicated that gramicidin was adding negative curvature to the monolayers. In this system, gramicidin was measured to have an apparent intrinsic radius of curvature (Rop*™") of -7. 1 A. The addition of up to 4 mol% gramicidin in mixtures with DOPE did not result in the monolayers becoming stiffer, as indicated by unaltered bending moduli for each composition. Dioleoylphosphatidylcholine (DOPC) alone forms the lamellar (LJ phase when hydrated, but undergoes a transition into the H^ phase when mixed with gramicidin. The lattice repeat dimension decreases systematically with increased gramicidin content. Again, this indicated that gramicidin was adding negative curvature to the monolayers. At 12 mol% gramicidin in mixtures with DOPC, the apparent radius of intrinsic curvature of gramicidin (Rop*"^) was measured to be -7.4 A. This mixture formed monolayers that were very resistant to bending under osmotic pressure, with a measured bending modulus of 1 15 kT. The measurements made in this study demonstrate that peptides are able to modulate the spontaneous curvature and other mechanical properties of phospholipid assemblies.

Spray Pyrolysed Zinc Oxide Thin Films : Effects of Doping and Ion Beam Irradiation

In recent years scientists have made rapid and significant advances in the field of semiconductor physics. One of the most important fields of current interest in materials science is the fundamental aspects and applications of conducting transparent oxide thin films (TCO). The characteristic properties of such coatings are low electrical resistivity and high transparency in the visible region. The first semitransparent and electrically conducting CdO film was reported as early as in 1907 [1]. Though early work on these films was performed out of purely scientific interest, substantial technological advances in such films were made after 1940. The technological interest in the study of transparent semiconducting films was generated mainly due to the potential applications of these materials both in industry and research. Such films demonstrated their utility as transparent electrical heaters for windscreens in the aircraft industry. However, during the last decade, these conducting transparent films have been widely used in a variety of other applications such as gas sensors [2], solar cells [3], heat reflectors [4], light emitting devices [5] and laser damage resistant coatings in high power laser technology [6]. Just a few materials dominate the current TCO industry and the two dominant markets for TCO’s are in architectural applications and flat panel displays. The architectural use of TCO is for energy efficient windows. Fluorine doped tin oxide (FTO), deposited using a pyrolysis process is the TCO usually finds maximum application. SnO2 also finds application ad coatings for windows, which are efficient in preventing radiative heat loss, due to low emissivity (0.16). Pyrolitic tin oxide is used in PV modules, touch screens and plasma displays. However indium tin oxide (ITO) is mostly used in the majority of flat panel display (FPD) applications. In FPDs, the basic function of ITO is as transparent electrodes. The volume of FPD’s produced, and hence the volume of ITO coatings produced, continues to grow rapidly. But the current increase in the cost of indium and the scarcity of this material created the difficulty in obtaining low cost TCOs. Hence search for alternative TCO materials has been a topic of active research for the last few decades. This resulted in the development of binary materials like ZnO, SnO2, CdO and ternary materials like II Zn2SnO4, CdSb2O6:Y, ZnSO3, GaInO3 etc. The use of multicomponent oxide materials makes it possible to have TCO films suitable for specialized applications because by altering their chemical compositions, one can control the electrical, optical, chemical and physical properties. But the advantages of using binary materials are the easiness to control the chemical compositions and depositions conditions. Recently, there were reports claiming the deposition of CdO:In films with a resistivity of the order of 10-5 ohm cm for flat panel displays and solar cells. However they find limited use because of Cd-Toxicity. In this regard, ZnO films developed in 1980s, are very useful as these use Zn, an abundant, inexpensive and nontoxic material. Resistivity of this material is still not very low, but can be reduced through doping with group-III elements like In, Al or Ga or with F [6]. Hence there is a great interest in ZnO as an alternative of ITO. In the present study, we prepared and characterized transparent and conducting ZnO thin films, using a cost effective technique viz Chemical Spray Pyrolysis (CSP). This technique is also suitable for large area film deposition. It involves spraying a solution, (usually aqueous) containing soluble salts of the constituents of the desired compound, onto a heated substrate.

Finite size effects on the structural and magnetic properties of sol–gel synthesized NiFe2O4 powders

Nanoparticles of nickel ferrite have been synthesized by the sol–gel method and the effect of grain size on its structural and magnetic properties have been studied in detail. X-ray diffraction (XRD) studies revealed that all the samples are single phasic possessing the inverse spinel structure. Grain size of the sol–gel synthesized powders has been determined from the XRD data and the strain graph. A grain size of 9 nm was observed for the as prepared powders of NiFe2O4 obtained through the sol–gel method. It was also observed that strain was induced during the firing process. Magnetization measurements have been carried out on all the samples prepared in the present series. It was found that the specific magnetization of the nanosized NiFe2O4 powders was lower than that of the corresponding coarse-grained counterparts and decreased with a decrease in grain size. The coercivity of the sol–gel synthesized NiFe2O4 nanoparticles attained a maximum value when the grain size was 15nm and then decreased as the grain size was increased further.

Finite size effects on the electrical properties of sol–gel synthesized CoFe2O4 powders: deviation from Maxwell–Wagner theory and evidence of surface polarization effects

Fine particles of cobalt ferrite were synthesized by the sol–gel method. Subsequent heat treatment at different temperatures yielded cobalt ferrites having different grain sizes. X-ray diffraction studies were carried out to elucidate the structure of all the samples. Dielectric permittivity and ac conductivity of all the samples were evaluated as a function of frequency, temperature and grain size. The variation of permittivity and ac conductivity with frequency reveals that the dispersion is due to Maxwell–Wagner type interfacial polarization in general, with a noted variation from the expected behaviour for the cold synthesized samples. High permittivity and conductivity for small grains were explained on the basis of the correlated barrier-hopping model

Proliferative and anti-proliferative effects of titanium- and iron-based metallocene anti-cancer drugs

In previous work we have found that Cp2TiCl2 and its corresponding deriv. of tamoxifen, Titanocene tamoxifen, show an unexpected proliferative effect on hormone dependent breast cancer cells MCF-7. In order to check if this behavior is a general trend for titanocene derivs. we have tested two other titanocene derivs., Titanocene Y and Titanocene K, on this cell line. Interestingly, these two titanocene complexes behave in a totally different manner. Titanocene K is highly proliferative on MCF-7 cells even at low concns. (0.5 .mu.M), thus behave almost similarly to Cp2TiCl2. This proliferative effect is also obsd. in the presence of bovine serum albumin (BSA). In contrast, Titanocene Y alone has almost no effect on MCF-7 at a concn. of 10 .mu.M, but exhibits a significant dose dependent cytotoxic effect of up to 50% when incubated with BSA (20-50 .mu.g/mL). This confirms the crucial role played by the binding to serum proteins in the expression of the in vivo, cytotoxicity of the titanocene complexes. From the hydridolithiation reaction of 6-p-anisylfulvene with LiBEt3H followed by transmetallation with iron dichloride [bis-[(p-methoxy-benzyl)cyclopentadienyl]iron(II)] (Ferrocene Y) was synthesized. This complex, which was characterized by single crystal X-ray diffraction, contains the robust ferrocenyl unit instead of Ti assocd. with easily leaving groups such as chlorine and shows only a modest cytotoxicity against MCF-7 or MDA-MB-231 cells.

Molecular structures of benzoic acid and 2-hydroxybenzoic acid, obtained by gas-phase electron diffraction and theoretical calculations

The structures of benzoic acid (C6H5COOH) and 2-hydroxybenzoic acid (C6H4OHCOOH) have been determined in the gas phase by electron diffraction using results from quantum chemical calculations to inform restraints used on the structural parameters. Theoretical methods (HF and MP2/6-311+G(d, p)) predict two conformers for benzoic acid, one which is 25.0 kJ mol(-1) (MP2) lower in energy than the other. In the low-energy form, the carboxyl group is coplanar with the phenyl ring and the O-H group eclipses the C=O bond. Theoretical calculations (HF and MP2/6-311+ G(d, p)) carried out for 2-hydroxybenzoic acid gave evidence for seven stable conformers but one low-energy form (11.7 kJ mol-1 lower in energy (MP2)) which again has the carboxyl group coplanar with the phenyl ring, the O-H of the carboxyl group eclipsing the C=O bond and the C=O of the carboxyl group oriented toward the O-H group of the phenyl ring. The effects of internal hydrogen bonding in 2-hydroxybenzoic acid can be clearly observed by comparison of pertinent structural parameters between the two compounds. These differences for 2-hydroxybenzoic acid include a shorter exocyclic C-C bond, a lengthening of the ring C-C bond between the substituents, and a shortening of the carboxylic single C-O bond.

Molecular structures of 3-hydroxybenzoic acid and 4-hydroxybenzoic acid, obtained by gas-phase electron diffraction and theoretical calculations

The structures of 3-hydroxybenzoic acid and 4-hydroxybenzoic acid have been determined by gas-phase electron diffraction using results from quantum chemical calculations to inform the choice of restraints applied to some of the structural parameters. The results from the study presented here demonstrate that resonance hybrids are not as helpful in rationalizing the structures of 2-, 3-, and 4-hydroxybenzoic acids as are models based upon electrostatic effects.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Steric effects on uranyl complexation: synthetic, structural, and theoretical studies of carbamoyl pyrazole compounds of the uranyl(VI) ion

New bifunctional pyrazole based ligands of the type [C3HR2N2CONR'] (where R = H or CH3; R' = CH3, C2H5, or (C3H7)-C-i) were prepared and characterized. The coordination chemistry of these ligands with uranyl nitrate and uranyl bis(dibenzoyl methanate) was studied with infrared (IR), H-1 NMR, electrospray-mass spectrometry (ES-MS), elemental analysis, and single crystal X-ray diffraction methods. The structure of compound [UO2(NO3)(2)(C3H3N2CON{C2H5}(2))] (2) shows that the uranium(VI) ion is surrounded by one nitrogen atom and seven oxygen atoms in a hexagonal bipyramidal geometry with the ligand acting as a bidentate chelating ligand and bonds through both the carbamoyl oxygen and pyrazolyl nitrogen atoms. In the structure of [UO2(NO3)(2)(H2O)(2)(C5H7N2CON {C2H5}(2))(2)], (5) the pyrazole figand acts as a second sphere ligand and hydrogen bonds to the water molecules through carbamoyl oxygen and pyrazolyl nitrogen atoms. The structure of [UO2(DBM)(2)C3H3N2CON{C2H5}(2)] (8) (where DBM = C6H5COCHCOC6H5) shows that the pyrazole ligand acts as a monodentate ligand and bonds through the carbamoyl oxygen to the uranyl group. The ES-MS spectra of 2 and 8 show that the ligand is similarly bonded to the metal ion in solution. Ab initio quantum chemical studies show that the steric effect plays the key role in complexation behavior.

Effects of calcining conditions on the microstructure of sugar cane waste ashes (SCWA): Influence in the pozzolanic activation

in this paper a study of calcining conditions on the microstructural features of sugar cane waste ash (SCWA) is carried out. For this purpose, some microparticles (< 90 mu m) of sugar cane straw ash and sugar cane bagasse ash of samples calcined at 800 degrees C and 1000 are studied by combining the bright field and the dark field images with the electron diffraction patterns in the transmission electron microscopy (TEM). It is appreciated that the morphology and texture of these microparticles change when silicon or calcium are present. Furthermore, it is observed that iron oxide (magnetite Fe(3)O(4)) is located in the calcium-rich particles. The microstructural information is correlated with the results of a kinetic-diffusive model that allows the computing of the kinetic parameters of the pozzolanic reaction (mainly the reaction rate constant). The results show that the sugar cane wastes ash calcined at 800 and 1000 degrees C have properties indicative of high pozzolanic activity. The X-ray diffraction patterns, the TEM images and the pozzolanic activity tests show the influence of different factors on the activation of these ashes. (c) 2008 Elsevier Ltd. All rights reserved.

Joint Experimental and Theoretical Analysis of Order Disorder Effects in Cubic BaZrO(3) Assembled Nanoparticles under Decaoctahedral Shape

Periodic first-principles calculations based on density functional theory at the B3LYP level has been carried out to investigate the photoluminescence (PL) emission of BaZrO(3) assembled nanoparticles at room temperature. The defect created in the nanocrystals and their resultant electronic features lead to a diversification of electronic recombination within the BaZrO(3) band gap. Its optical phenomena are discussed in the light of photoluminescence emission at the green-yellow region around 570 nm. The theoretical model for displaced atoms and/or angular changes leads to the breaking of the local symmetry, which is based on the refined structure provided by Rietveld methodology. For each situation a band structure, charge mapping, and density of states were built and analyzed. X-ray diffraction (XRD) patterns, UV-vis measurements, and field emission scanning electron microscopy (FE-SEM) images are essential for a full evaluation of the crystal structure and morphology.

Structural effects and hydrogen bonds on N,N `-di(methoxycarbonylsulfenyl)urea, [CH(3)OC(O)SNH](2)CO, studied by experimental and theoretical methods

Pure N,N`-di(methoxycarbonylsulfenyl)urea, [CH(3)OC(O)SNH](2)CO, is quantitatively prepared by the hydrolysis reaction of CH(3)OC(O)SNCO and characterized by (1)H NMR, GC-MS and FTIR spectroscopy techniques. Structural and conformational properties are analyzed using a combined approach with data obtained from X-ray diffraction, vibrational spectra and theoretical calculation methods. The IR and Raman spectra for normal and deuterated species are reported. The crystal structure of [CH(3)OC(O)SNH](2)CO was determined by X-ray diffraction methods. The substance crystallizes in the orthorhombic P2(1)2(1)2 space group with a = 9.524(2), b = 12.003(1), c = 4.481 (1) angstrom, and Z = 2 moieties in the unit cell. The molecule is sited on a twofold crystallographic axis (C(2)) parallel to c and shows the anti-anti conformation (S-N single bonds antiperiplanar with respect to the opposite C-N single bonds in sulfenyl-urea-sic group). Neighboring molecules are arranged in a chain motif that extends along the C(2)-axis and is held by bifurcated NH center dot center dot center dot O center dot center dot center dot HN intermolecular bonds. A local planar symmetry is observed in the crystal for the central -SN(H)C(O)N(H)S- skeleton. Experimental and calculated data allow to trace this structural feature to the occurrence of N-H center dot center dot center dot O=C hydrogen bonding interactions. Calculated vibrational and structural properties are in good agreement with the experimentally determined features. (C) 2008 Elsevier B.V. All rights reserved.

Combined Crystallographic and Solution Molecular Dynamics Study of Allosteric Effects in Ester and Ketone p-tert-Butylcalix[4]arene Derivatives and Their Complexes with Acetonitrile, Cd(II), and Pb(II)

We describe here a procedure to bridge the gap in the field of calixarene physicochemistry between solid-state atomic-resolution structural information and the liquid-state low-resolution thermodynamics and spectroscopic data. We use MD simulations to study the kinetics and energetics involved in the complexation of lower rim calix[4]arene derivatives (L), containing bidentate ester (1) and ketone (2) pendant groups, with acetonitrile molecule (MeCN) and Cd2+ and Pb2+ ions (M2+) in acetonitrile solution. On one hand, we found that the prior inclusion of MeCN into the calix to form a L(MeCN) adduct has only a weak effect in preorganizing the hydrophilic cavity toward metal ion binding. On the other hand, the strong ion-hydrophilic cavity interaction produces a wide open calix which enhances the binding of one MeCN molecule (allosteric effect) to stabilize the whole (M2+)1(MeCN) bifunctional complex. We reach two major conclusions: (i) the MD results for the (M2+)1(MeCN) binding are in close agreement with the ""endo"", fully encapsulated, metal complex found by X-ray diffraction and in vacuo MD calculations, and (ii) the MD structure for the more flexible 2 ligand, however, differs from the also endo solid-state molecule. In fact, it shows strong solvation effects at the calixarene lower bore by competing MeCN molecules that share the metal coordination sphere with the four C=O oxygens of an ""exo"" (M2+)2(MeCN) complex.

Optimization of performances of gelatin/LiBF(4)-based polymer electrolytes by plasticizing effects

Gelatin is a cheap and abundant natural product with very good biodegradation properties and can be used to obtain acetic acid or LiClO(4)-based gel polymer electrolytes (GPEs) with high ionic conductivity and good stability. This article presents results of GPEs obtained by the plasticization of gelatin and addition of LiBF(4), where the optimization of the system was achieved by using a factorial design type 22 with two variables: glycerol and LiBF(4). From this analysis it was stated that the effect of glycerol as a plasticizer on the ionic conductivity results is much more important than the effect obtained by varying the lithium salt content or the effect of the interaction of both variables. Also all the samples were characterized by X-ray diffraction measurements, UV-vis-NIR spectroscopy and scanning electron microscopy (SEM) and impedance spectroscopy. The ionic conductivity results of all analyzed samples as a function of temperature obey predominantly an Arrhenius relationship and the samples are stable up to 160 degrees C. Good conductivity results combined with transparency and good adhesion to the electrodes have shown that gelatin-based GPEs are very promising materials to be used as solid electrolytes in electrochromic devices. (C) 2009 Elsevier Ltd. All rights reserved.

Effects of MWNT nanofillers on structures and properties of PVA electrospun nanofibres

In this study, we have electrospun poly(vinyl alcohol)(PVA) nanofibres and PVA composite nanofibres containing multi-wall carbon nanotubes (MWNTs) (4.5 wt%), and examined the effect of the carbon nanotubes and the PVA morphology change induced by post-spinning treatments on the tensile properties, surface hydrophilicity and thermal stability of the nanofibres. Through differential scanning calorimetry (DSC) and wide-angle x-ray diffraction (WAXD) characterizations, we have observed that the presence of the carbon nanotubes nucleated crystallization of PVA in the MWNTs/PVA composite nanofibres, and hence considerably improved the fibre tensile strength. Also, the presence of carbon nanotubes in PVA reduced the fibre diameter and the surface hydrophilicity of the nanofibre mat. The MWNTs/PVA composite nanofibres and the neat PVA nanofibres responded differently to post-spinning treatments, such as soaking in methanol and crosslinking with glutaric dialdehyde, with the purpose of increasing PVA crystallinity and establishing a crosslinked PVA network, respectively. The presence of carbon nanotubes reduced the PVA crystallization rate during the methanol treatment, but prevented the decrease of crystallinity induced by the crosslinking reaction. In comparison with the crosslinking reaction, the methanol treatment resulted in better improvement in the fibre tensile strength and less reduction in the tensile strain. In addition, the presence of carbon nanotubes reduced the onset decomposition temperature of the composite nanofibres, but stabilized the thermal degradation for the post-spinning treated nanofibres. The MWNTs/PVA composite nanofibres treated by both methanol and crosslinking reaction gave the largest improvement in the fibre tensile strength, water contact angle and thermal stability.