993 resultados para specific load
Resumo:
The primary aim of this study was to compare rating of perceived exertion (RPE) values measuring repetitions in reserve (RIR) at particular intensities of 1 repetition maximum (RM) in experienced (ES) and novice squatters (NS). Furthermore, this investigation compared average velocity between ES and NS at the same intensities. Twenty-nine individuals (24.0 ± 3.4 years) performed a 1RM squat followed by a single repetition with loads corresponding to 60, 75, and 90% of 1RM and an 8-repetition set at 70% 1RM. Average velocity was recorded at 60, 75, and 90% 1RM and on the first and last repetitions of the 8-repetition set. Subjects reported an RPE value that corresponded to an RIR value (RPE-10 = 0-RIR, RPE-9 = 1-RIR, and so forth). Subjects were assigned to one of the 2 groups: (a) ES (n = 15, training age: 5.2 ± 3.5 years) and (b) NS (n = 14, training age: 0.4 ± 0.6 years). The mean of the average velocities for ES was slower (p ≤ 0.05) than NS at 100% and 90% 1RM. However, there were no differences (p > 0.05) between groups at 60, 75%, or for the first and eighth repetitions at 70% 1RM. In addition, ES recorded greater RPE at 1RM than NS (p = 0.023). In ES, there was a strong inverse relationship between average velocity and RPE at all percentages (r = −0.88, p < 0.001), and a strong inverse correlation in NS between average velocity and RPE at all intensities (r = −0.77, p = 0.001). Our findings demonstrate an inverse relationship between average velocity and RPE/RIR. Experienced squatter group exhibited slower average velocity and higher RPE at 1RM than NS, signaling greater efficiency at high intensities. The RIR-based RPE scale is a practical method to regulate daily training load and provide feedback during a 1RM test.
Resumo:
One of the most popular sports globally, soccer has seen a rise in the demands of the game over recent years. An increase in intensity and playing demands, coupled with growing social and economic pressures on soccer players means that optimal preparation is of paramount importance. Recent research has found the modern game, depending on positional role, to consist of approximately 60% more sprint distance in the English Premier League, which was also found to be the case for frequency and success of discrete technical actions (Bush et al., 2015). As a result, the focus on soccer training and player preparedness is becoming more prevalent in scientific research. By designing the appropriate training load, and thus periodization strategies, the aim is to achieve peak fitness in the most efficient way, whilst minimising the risk of injury and illness. Traditionally, training intensity has been based on heart rate responses, however, the emergence of tracking microtechnology such as global positioning system (GPS) and inertial sensors are now able to further quantify biomechanical load as well as physiological stress. Detailed pictures of internal and external loading indices such as these then combine to produce a more holistic view of training load experience by the player during typical drills and phases of training in soccer. The premise of this research is to gain greater understanding of the physical demands of common training methodologies in elite soccer to support optimal match performance. The coaching process may then benefit from being able to prescribe the most effective training to support these. The first experimental chapter in this thesis began by quantify gross training loads of the pre-season and in-season phases in soccer. A broader picture of the training loads inherent in these distinct phases brought more detail as to the type and extent of external loading experienced by soccer players at these times, and how the inclusion of match play influences weekly training rhythms. Training volume (total distance) was found to be high at the start compared to the end of pre-season (37 kilometres and 28 kilometres), where high cardiovascular loads were attained as part of the conditioning focus. This progressed transiently, however, to involve higher-speed, acceleration and change-of-direction stimuli at the end of pre-season compared to the start and to that in-season (1.18 kilometres, 0.70 kilometres and 0.42 kilometres high-intensity running; with 37, 25 and 23 accelerations >3m/s2 respectively) . The decrease in volume and increase in maximal anaerobic activity was evident in the training focus as friendly matches were introduced before the competitive season. The influence of match-play as being a large physical dose in the training week may then determine the change in weekly periodisation and how resulting training loads applied and tapered, if necessary. The focus of research was then directed more specifically to the most common mode of training in soccer, that also featured regularly in the pre-season period in the present study, small-sided games (SSG). The subsequent studies examined numerous manipulations of this specific form of soccer conditioning, such as player numbers as well as absolute and relative playing space available. In contrast to some previous literature, changing the number of players did not seem to influence training responses significantly, although playing format in the possession style brought about larger effects for heart rate (89.9%HRmax) and average velocity (7.6km/h-1). However, the following studies (Chapters 5, 6 and 7) revealed a greater influence of relative playing space available to players in SSG. The larger area at their disposal brought about greater aerobic responses (~90%HRmax), by allowing higher average and peak velocities (>25km/h-1), as well as greater distance acceleration behaviour at greater thresholds (>2.8m/s2). Furthermore, the data points towards space as being a large determinant in strategy of the player in small-sided games (SSG), subsequently shaping their movement behaviour and resulting physical responses. For example, higher average velocities in a possession format (8km/h-1) reflects higher work rate and heart rate load but makes achieving significant neuromuscular accelerations at a high level difficult given higher starting velocities prior to the most intense accelerations (4.2km/h-1). By altering space available and even through intentional numerical imbalances in team numbers, it may be easier for coaches to achieve the desired stimulus for the session or individual player, whether that is for aerobic and neuromuscular conditioning. Large effects were found for heart rate being higher in the underloaded team (85-90%HRmax) compared to the team with more players (80-85%HRmax) as well as for RPE (5AU versus 7AU). This was also apparent for meterage and therefore average velocity. It would also seem neuromuscular load through high acceleration and deceleration efforts were more pronounced with less numbers (given the need to press and close down opponents, and in a larger area relative to the number of players on the underloaded team. The peak accelerations and deceleration achieved was also higher when playing with less players (3-6.2m/s2 and 3-6.1m/s2) Having detailed ways in which to reach desired physical loading responses in common small training formats, Chapter 8 compared SSG to larger 9v9 formats with full-size 11v11 friendly matches. This enabled absolute and relative comparisons to be made and to understand the extent to which smaller training formats are able to replicate the required movements to be successful in competition. In relative terms, it was revealed that relative acceleration distance and Player Load were higher in smaller 4v4 games than match-play (1.1m.min-1 and 0.3m.min-1 >3m/s2; 16.9AU versus 12AU). Although the smallest format did not replicate the high-velocity demands of matches, the results confirmed their efficacy in providing significant neuromuscular load during the training week, which may then be supplemented by high-intensity interval running in order to gain exposure to more maximal speed work. In summary, the data presented provide valuable information from GPS and inertial sensor microtechnology which may then be used to understand training better to manipulate types of load according to physical conditioning objectives. For example, a library of resources to direct planning of drills of varying cardiovascular, neuromuscular and perceptual load can be created to give more confidence in session outcomes. Combining external and internal load data of common soccer training drills, and their application across different phases and training objectives may give coaches a powerful tool to plan and periodize training.
Resumo:
The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.
Resumo:
This study proposed to evaluate the mandibular biomechanics in the posterior dentition based on experimental and computational analyses. The analyses were performed on a model of human mandible, which was modeled by epoxy resin for photoelastic analysis and by computer-aided design for finite element analysis. To standardize the evaluation, specific areas were determined at the lateral surface of mandibular body. The photoelastic analysis was configured through a vertical load on the first upper molar and fixed support at the ramus of mandible. The same configuration was used in the computer simulation. Force magnitudes of 50, 100, 150, and 200 N were applied to evaluate the bone stress. The stress results presented similar distribution in both analyses, with the more intense stress being at retromolar area and oblique line and alveolar process at molar level. This study presented the similarity of results in the experimental and computational analyses and, thus, showed the high importance of morphology biomechanical characterization at posterior dentition.
Resumo:
Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.
Resumo:
The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
OBJECTIVES: The purpose of this in vitro study was to evaluate misfit alterations at the implant/abutment interface of external and internal connection implant systems when subjected to cyclic loading. MATERIAL AND METHODS: Standard metal crowns were fabricated for 5 groups (n=10) of implant/abutment assemblies: Group 1, external hexagon implant and UCLA cast-on premachined abutment; Group 2, internal hexagon implant and premachined abutment; Group 3, internal octagon implant and prefabricated abutment; Group 4, external hexagon implant and UCLA cast-on premachined abutment; and Group 5, external hexagon implant and Ceraone abutment. For groups 1, 2, 3 and 5, the crowns were cemented on the abutments and in group 4 crowns were screwed directly on the implant. The specimens were subjected to 500,000 cycles at 19.1 Hz of frequency and non-axial load of 133 N in a MTS 810 machine. The vertical misfit (μm) at the implant/abutment interface was evaluated before (B) and after (A) application of the cyclic loading. Data were analyzed statistically by using two-away ANOVA and Tukey's post-hoc test (p<0.05). RESULTS: Before loading values showed no difference among groups 2 (4.33±3.13), 3 (4.79±3.43) and 5 (3.86±4.60); between groups 1 (12.88±6.43) and 4 (9.67±3.08), and among groups 2, 3 and 4. However, groups 1 and 4 were significantly different from groups 2, 3 and 5. After loading values of groups 1 (17.28±8.77) and 4 (17.78±10.99) were significantly different from those of groups 2 (4.83±4.50), 3 (8.07±4.31) and 5 (3.81±4.84). There was a significant increase in misfit values of groups 1, 3 and 4 after cyclic loading, but not for groups 2 and 5. CONCLUSIONS: The cyclic loading and type of implant/abutment connection may develop a role on the vertical misfit at the implant/abutment interface.