815 resultados para cold events
Resumo:
Cold-water corals form prominent reef ecosystems along ocean margins that depend on suspended resources produced in surface waters. In this study, we investigated food processing of 13C and 15N labelled bacteria and algae by the cold-water coral Lophelia pertusa. Coral respiration, tissue incorporation of C and N and metabolic-derived C incorporation into the skeleton were traced following the additions of different food concentrations (100, 300, 1300 µg C/l) and two ratios of suspended bacterial and algal biomass (1:1, 3:1). Respiration and tissue incorporation by L. pertusa increased markedly following exposure to higher food concentrations. The net growth efficiency of L. pertusa was low (0.08±0.03), which is consistent with their slow growth rates. The contribution of algae and bacteria to total coral assimilation was proportional to the food mixture in the two lowest food concentrations, but algae were preferred over bacteria as food source at the highest food concentration. Similarly, the stoichiometric uptake of C and N was coupled in the low and medium food treatment, but was uncoupled in the high food treatment and indicated a comparatively higher uptake or retention of bacterial carbon as compared to algal nitrogen. We argue that behavioural responses for these small-sized food particles, such as tentacle behaviour, mucus trapping and physiological processing, are more likely to explain the observed food selectivity as compared to physical-mechanical considerations. A comparison of the experimental food conditions to natural organic carbon concentrations above CWC reefs suggests that L. pertusa is well adapted to exploit temporal pulses of high organic matter concentrations in the bottom water caused by internal waves and down-welling events.
Resumo:
The West African Monsoon (WAM) and its representation in numerical models are strongly influenced by the Saharan Heat Low (SHL), a low-pressure system driven by radiative heating over the central Sahara and ventilated by the cold and moist inflow from adjacent oceans. It has recently been shown that a significant part of the southerly moisture flux into the SHL originates from convective cold pools over the Sahel. These density currents driven by evaporation of rain are largely absent in models with parameterized convection. This crucial issue has been hypothesized to contribute to the inability of many climate models to reproduce the variability of the WAM. Here, the role of convective cold pools approaching the SHL from the Atlas Mountains, which are a strong orographic trigger for deep convection in Northwest Africa, is analyzed. Knowledge about the frequency of these events, as well as their impact on large-scale dynamics, is required to understand their contribution to the variability of the SHL and to known model uncertainties. The first aspect is addressed through the development of an objective and automated method for the generation of multi-year climatologies not available before. The algorithm combines freely available standard surface observations with satellite microwave data. Representativeness of stations and influence of their spatial density are addressed by comparison to a satellite-only climatology. Applying this algorithm to data from automated weather stations and manned synoptic stations in and south of the Atlas Mountains reveals the frequent occurrence. On the order of 6 events per month are detected from May to September when the SHL is in its northernmost position. The events tend to cluster into several-days long convectively active periods, often with strong events on consecutive days. This study is the first to diagnose dynamical impacts of such periods on the SHL, based on simulations of two example cases using the Weather Research and Forecast (WRF) model at convection-permitting resolution. Sensitivity experiments with artificially removed cold pools as well as different resolutions and parameterizations are conducted. Results indicate increases in surface pressure of more than 1 hPa and significant moisture transports into the desert over several days. This moisture affects radiative heating and thus the energy balance of the SHL. Even though cold pool events north of the SHL are less frequent when compared to their Sahelian counterparts, it is shown that they gain importance due to their temporal clustering on synoptic timescale. Together with studies focusing on the Sahel, this work emphasizes the need for improved parameterization schemes for deep convection in order to produce more reliable climate projections for the WAM.
Resumo:
Hevea brasiliensis is a native species of the Amazon Basin of South America and the primary source of natural rubber worldwide. Due to the occurrence of South American Leaf Blight disease in this area, rubber plantations have been extended to suboptimal regions. Rubber tree breeding is time-consuming and expensive, but molecular markers can serve as a tool for early evaluation, thus reducing time and costs. In this work, we constructed six different cDNA libraries with the aim of developing gene-targeted molecular markers for the rubber tree. A total of 8,263 reads were assembled, generating 5,025 unigenes that were analyzed; 912 expressed sequence tags (ESTs) represented new transcripts, and two sequences were highly up-regulated by cold stress. These unigenes were scanned for microsatellite (SSR) regions and single nucleotide polymorphisms (SNPs). In total, 169 novel EST-SSR markers were developed; 138 loci were polymorphic in the rubber tree, and 98 % presented transferability to six other Hevea species. Locus duplication was observed in H. brasiliensis and other species. Additionally, 43 SNP markers in 13 sequences that showed similarity to proteins involved in stress response, latex biosynthesis and developmental processes were characterized. cDNA libraries are a rich source of SSR and SNP markers and enable the identification of new transcripts. The new markers developed here will be a valuable resource for linkage mapping, QTL identification and other studies in the rubber tree and can also be used to evaluate the genetic variability of other Hevea species, which are valuable assets in rubber tree breeding.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.
Resumo:
Filleting yield of Nile tilapia Oreochromis niloticus (L.) is low (30%) and generates large amount of wastes that may turn into environmental and economic problem. However, these wastes can be used for the extraction of minced fish (MF) which can be used in the preparation of sausages. The objective of this study was to assess the quality of sausages prepared with 0, 20, 40, 60, 80 and 100% of MF from Nile tilapia filleting waste during storage at 0±0.3ºC. Alterations in the instrumental color (L*, a* and b*), lipid oxidation (TBARS), total volatile nitrogenous bases (TVB-N), pH, microbiological condition (pathogenic bacteria and aerobic psychrotrophic bacteria), and sensory attributes (color, odor, flavor, texture and overall acceptability) were evaluated for up to 40 days. The addition of MF to sausages increased TBARS values and decreases TVB-N, L*, a* and b* values. Acceptability of color attribute decreased with increasing MF; best flavor, texture and overall acceptability scores were registered for sausages containing 40 and 60% MF; best odor was registered for 100% MF. Pathogenic microorganisms were not detected, but decrease in pH and proliferation of aerobic psychrotrophic bacteria which, however, did not compromise sensory evaluation of sausages were registered throughout storage. Sausages prepared with MF from tilapia filleting waste have a shelf-life of 40 days when stored at 0±0.3ºC, and the maximum recommended MF inclusion to maintain good sensory quality is 60%.
Resumo:
Foram analisadas características da precipitação estimada a partir de 145.194 campos de refletividade, de um total de 827 dias entre 1998 e 2003, obtidos do Radar Meteorológico de São Paulo (RSP). Os eventos foram classificados de acordo com intensidades de precipitação; em Convectivos (EC) e Estratiformes (EE). Quanto à morfologia, cinco tipos de sistemas foram identificados; Convecção Isolada (CI), Brisa Marítima (BM), Linhas de Instabilidade (LI), Bandas Dispersas (BD) e Frentes Frias (FF). Eventos convectivos dominam na primavera e verão e estratiformes no outono e inverno. A CI e a BM tiveram maiores picos de atuação entre outubro e março enquanto as FF de abril a setembro. BD atuam durante todo o ano e as LI só não foram observadas nos meses de junho e julho. Uma comparação pontual entre a precipitação medida pela telemetria e estimada com o radar foi realizada e, mostrou haver, na maioria dos casos, um viés positivo do RSP, para acumulações de 10, 30 e 60 minutos. Com o objetivo de integrar as estimativas de precipitação do radar com as medidas da rede telemétrica, por meio de uma análise objetiva estatística, foram obtidas dos campos de precipitação do radar as estruturas das correlações espaciais em função da distância para acumulações de chuva de 15, 30, 60 e 120 minutos para os cinco tipos de sistemas precipitantes que foram caracterizados. As curvas das correlações espaciais médias de todos os eventos de precipitação de cada sistema foram ajustadas por funções polinomiais de sexta ordem. Os resultados indicam diferenças significativas na estrutura espacial das correlações entre os sistemas precipitantes.
Resumo:
Happy emotional states have not been extensively explored in functional magnetic resonance imaging studies using autobiographic recall paradigms. We investigated the brain circuitry engaged during induction of happiness by standardized script-driven autobiographical recall in 11 healthy subjects (6 males), aged 32.4 ± 7.2 years, without physical or psychiatric disorders, selected according to their ability to vividly recall personal experiences. Blood oxygen level-dependent (BOLD) changes were recorded during auditory presentation of personal scripts of happiness, neutral content and negative emotional content (irritability). The same uniform structure was used for the cueing narratives of both emotionally salient and neutral conditions, in order to decrease the variability of findings. In the happiness relative to the neutral condition, there was an increased BOLD signal in the left dorsal prefrontal cortex and anterior insula, thalamus bilaterally, left hypothalamus, left anterior cingulate gyrus, and midportions of the left middle temporal gyrus (P < 0.05, corrected for multiple comparisons). Relative to the irritability condition, the happiness condition showed increased activity in the left insula, thalamus and hypothalamus, and in anterior and midportions of the inferior and middle temporal gyri bilaterally (P < 0.05, corrected), varying in size between 13 and 64 voxels. Findings of happiness-related increased activity in prefrontal and subcortical regions extend the results of previous functional imaging studies of autobiographical recall. The BOLD signal changes identified reflect general aspects of emotional processing, emotional control, and the processing of sensory and bodily signals associated with internally generated feelings of happiness. These results reinforce the notion that happiness induction engages a wide network of brain regions.
Resumo:
The aim of this study was to determine the short-term environmental changes caused by the simultaneous passage of a high energy event on two sandy beaches with different morphodynamic states and their influence on the richness, abundance and distribution of the benthic macrofauna. Two microtidal exposed sandy beaches with contrasting morphodynamics were simultaneously sampled before, during and after the passage of two cold fronts in Santa Catarina. The reflective beach showed a higher susceptibility to the increase in wave energy produced by the passage of cold fronts and was characterized by rapid and intense erosive processes in addition to a capacity for rapid restoration of the beach profile. As regards the dissipative beach, erosive processes operated more slowly and progressively, and it was characterized further by a reduced capacity for the recovery of its sub-aerial profile. Although the intensity of the environmental changes was distinct as between the morphodynamic extremes, changes in the composition, richness and abundance of macrobenthos induced by cold fronts were not evident for either of the beaches studied. On the other hand, alterations in the distribution pattern of the macrofauna were observed on the two beaches and were related to variations in sea level, position of the swash zone and moisture gradient, suggesting that short-term accommodations in the spatial structure of the macrobenthos occur in response to changes in environmental conditions in accordance with the temporal dynamics characteristic of each morphodynamic state.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
OBJECTIVES: Memantine is an N-methyl-d-aspartate (NMDA) glutamate receptor antagonist used to treat Alzheimer's disease. Previous studies have suggested that receptor blockers act as neuroprotective agents; however, no study has specifically investigated the impact that these drugs have on the heart. We sought to evaluate the effects of memantine on nuclear size reduction in cardiac cells exposed to cold stress. METHOD: We used male EPM-Wistar rats (n=40) divided into 4 groups: 1) Matched control (CON); 2) Memantine-treated rats (MEM); 3) Rats undergoing induced hypothermia (IH) and 4) Rats undergoing induced hypothermia that were also treated with memantine (IHM). Animals in the MEM and IHM groups were treated by oral gavage administration of 20 mg/kg/day memantine over an eight-day period. Animals in the IH and IHM groups were submitted to 4 hours of hypothermia in a controlled environment with a temperature of - 8ºC on the last day of the study. RESULTS: The MEM group had the largest cardiomyocyte nuclear size (151 ± 3.5 μm³ vs. CON: 142 ± 2.3 μm³; p<0.05), while the IH group had the smallest mean value of nuclear size. The nuclear size of the IHM group was preserved (125 ± 2.9 μm³) compared to the IH group (108 ± 1.7 μm³; p<0.05). CONCLUSION: Memantine prevented the nuclear size reduction of cardiomyocytes in rats exposed to cold stress.
Resumo:
We estimated the sensitivity, i.e., the proportion of all cases of adverse events following immunization (AEFIs) reported to the Brazilian passive surveillance for adverse events following immunization (PSAEFI) with the diphtheria-tetanus-whole-cell pertussis-Haemophilus influenzae type b (DTwP-Hib) vaccine, as well as investigating factors associated with AEFIs reporting. During 2003–2004, 8303 AEFIs associated with DTwP-Hib were reported; hypotonic-hyporesponsive episodes (HHEs), fever and convulsions being the most common. Cure without sequel was achieved in 98.4 per cent of the cases. The mean sensitivity of the PSAEFI was 22.3 per cent and 31.6 per cent, respectively, for HHE and convulsions, varying widely among states. Reporting rates correlated positively with the Human Development Index and coverage of adequate prenatal care, correlating negatively with infant mortality rates. Quality of life indicators and the degree of organization of health services are associated with greater PSAEFI sensitivity. In addition to consistently describing the principal AEFIs, PSAEFI showed the DTwP/Hib vaccine to be safe and allayed public fears related to its use
Resumo:
In this work, a low alloy steel and a fabrication process were developed to produce U-Bolts for commercial vehicles. Thus, initially five types of no-heat treated steel were developed with different additions of chrome, nickel, and silicon to produce strain hardening effect during cold-forming processing of the U-Bolts, assuring the required mechanical properties. The new materials exhibited a fine perlite and ferrite microstructure due to aluminum and vanadium additions, well known as grain size refiners. The mechanical properties were evaluated in a servo-hydraulic test machine system-MTS 810 according to ASTM A370-03; E739 and E08m-00 standards. The microstructure and fractography analyses of the cold-formed steels were performed by using optical and scanning electronic microscope techniques. To evaluate the performance of the steels and the production process, fatigue tests were carried out under load control (tensile-tensile), R = 0.1 and f = 30 Hz. The Weibull statistic methodology was used for the analysis of the fatigue results. At the end of this work the 0.21% chrome content steel, Alloy 2, presented the best fatigue performance.
Resumo:
A compact frequency standard based on an expanding cold (133)CS cloud is under development in our laboratory. In a first experiment, Cs cold atoms were prepared by a magneto-optical trap in a vapor cell, and a microwave antenna was used to transmit the radiation for the clock transition. The signal obtained from fluorescence of the expanding cold atoms cloud is used to lock a microwave chain. In this way the overall system stability is evaluated. A theoretical model based on a two-level system interacting with the two microwave pulses enables interpretation for the observed features, especially the poor Ramsey fringes contrast. (C) 2008 Optical Society of America.