998 resultados para SPECIFIC GENOTYPE


Relevância:

30.00% 30.00%

Publicador:

Resumo:

The diagnosis of mixed genotype hepatitis C virus (HCV) infection is rare and information on incidence in the UK, where genotypes 1a and 3 are the most prevalent, is sparse. Considerable variations in the efficacies of direct-acting antivirals (DAAs) for the HCV genotypes have been documented and the ability of DAAs to treat mixed genotype HCV infections remains unclear, with the possibility that genotype switching may occur. In order to estimate the prevalence of mixed genotype 1a/3 infections in Scotland, a cohort of 512 samples was compiled and then screened using a genotype-specific nested PCR assay. Mixed genotype 1a/3 infections were found in 3.8% of samples tested, with a significantly higher prevalence rate of 6.7% (p<0.05) observed in individuals diagnosed with genotype 3 infections than genotype 1a (0.8%). An analysis of the samples using genotypic-specific qPCR assays found that in two-thirds of samples tested, the minor strain contributed <1% of the total viral load. The potential of deep sequencing methods for the diagnosis of mixed genotype infections was assessed using two pan-genotypic PCR assays compatible with the Illumina MiSeq platform that were developed targeting the E1-E2 and NS5B regions of the virus. The E1-E2 assay detected 75% of the mixed genotype infections, proving to be more sensitive than the NS5B assay which identified only 25% of the mixed infections. Studies of sequence data and linked patient records also identified significantly more neurological disorders in genotype 3 patients. Evidence of distinctive dinucleotide expression within the genotypes was also uncovered. Taken together these findings raise interesting questions about the evolutionary history of the virus and indicate that there is still more to understand about the different genotypes. In an era where clinical medicine is frequently more personalised, the development of diagnostic methods for HCV providing increased patient stratification is increasingly important. This project has shown that sequence-based genotyping methods can be highly discriminatory and informative, and their use should be encouraged in diagnostic laboratories. Mixed genotype infections were challenging to identify and current deep sequencing methods were not as sensitive or cost-effective as Sanger-based approaches in this study. More research is needed to evaluate the clinical prognosis of patients with mixed genotype infection and to develop clinical guidelines on their treatment.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The first study was designed to assess whether the involvement of the peripheral nervous system (PNS) belongs to the phenotypic spectrum of sporadic Creutzfeldt-Jakob disease (sCJD). To this aim, we reviewed medical records of 117 sCJDVV2, 65 sCJDMV2K, and 121 sCJDMM(V)1 subjects for symptoms/signs and neurophysiological data. We looked for the presence of PrPSc in postmortem PNS samples from 14 subjects by western blotting and real-time quaking-induced conversion (RT-QuIC) assay. Seventy-five (41.2%) VV2-MV2K patients, but only 11 (9.1%) MM(V)1, had symptoms/signs suggestive of PNS involvement and neuropathy was documented in half of the VV2-MV2K patients tested. RT-QuIC was positive in all PNS samples, whereas western blotting detected PrPSc in the sciatic nerve in only one VV2 and one MV2K. These results support the conclusion that peripheral neuropathy, likely related to PrPSc deposition, belongs to the phenotypic spectrum of sCJDMV2K and VV2, the two variants linked to the V2 strain. The second study aimed to characterize the genetic/molecular determinants of phenotypic variability in genetic CJD (gCJD). To this purpose, we compared 157 cases of gCJD to 300 of sCJD. We analyzed: demographic aspects, neurological symptoms/signs, histopathologic features and biochemical characteristics of PrPSc. The results strongly indicated that the clinicopathological phenotypes of gCJD largely overlap with those of sCJD and that the genotype at codon 129 in cis with the mutation (i.e. haplotype) contributes more than the latter to the disease phenotype. Some mutations, however, cause phenotypic variations including haplotype-specific patterns of PrPSc deposition such as the “dense” synaptic pattern (E200K-129M), the intraneuronal dots (E200K-129V), and the linear stripes perpendicular to the surface in the molecular layer of cerebellum (OPRIs-129M). Overall, these results suggest that in gCJD PRNP mutations do not cause the emergence of novel prion strains, but rather confer increased susceptibility to the disease in conjunction with “minor” clinicopathological variations.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Down syndrome (DS) or trisomy 21 (T21) is the most common genetic cause of intellectual disability (ID). Subjects with DS are characterized by complex and variable clinical features including intellectual disability (ID) and craniofacial dysmorphisms. The aim of the thesis is to uncover genotype-phenotype relationships in DS possibly useful to devise therapies based on molecular and cellular mechanisms. In this work, we have investigated different aspects of DS: - we have collected clinical data of children with DS and we have evaluated the cognitive impairment through specific cognitive tests - we have analysed genomics of DS through the study of partial trisomy (PT21) cases. We have described new PT21 cases confirming the hypothesis of the highly restricted DS critical region (HR-DSCR) recently identified as the minimal region whose duplication is shared by all PT21 subjects diagnosed with DS, while it is absent in all PT21 non-DS subjects. Moreover, we have characterized new transcripts included in the HR-DSCR; - we have studied gene expression through RNAseq in blood cells of children with DS; -metabolic alterations in plasma of children with DS were identified through different methods: Nuclear Magnetic resonance, routine blood exams performed during the follow up of the subjects and enzyme-linked immunosorbent assay (ELISA); - to test possible correlations between specific Hsa21 regions and alterations in transcriptomics and metabolomics, we have used trisomic iPSCs and differentiated them into neuronal derivatives. Significant alterations in gene expression and metabolic profiles have been identified, as well as significant correlations with clinical and cognitive aspects. Specific genes and the HR-DSCR may play a role in these alterations: cell models need to be developed to investigate this role. Neural derivatives from trisomic iPSCs are a promising model to better understand genotype-phenotype correlations in DS.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Nocardia is a rare opportunistic agent, which may affect immunocompromised individuals causing lung infections and exceptionally infective endocarditis (IE). There are few reports of IE caused by Nocardia sp., usually involving biological prostheses but rarely in natural valves. Its accurate microbiological identification may be hampered by the similarity with Rhodococcus equi and Corynebacterium spp. Here we report a case of native mitral valve IE caused by this agent in which the clinical absence of response to vancomycin and the suggestion of Nocardia sp. by histology pointed to the misdiagnosis of Corynebacterium spp. in blood cultures. The histological morphology can advise on the need for expansion of cultivation time and use of extra microbiological procedures that lead to the differential diagnosis with Corynebacterium spp. and other agents, which is essential to establish timely specific treatment, especially in immunocompromised patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

BACKGROUND: Rett syndrome (RS) is a severe neurodevelopmental X-linked dominant disorder caused by mutations in the MECP2 gene. PURPOSE: To search for point mutations on the MECP2 gene and to establish a correlation between the main point mutations found and the phenotype. METHOD: Clinical evaluation of 105 patients, following a standard protocol. Detection of point mutations on the MECP2 gene was performed on peripheral blood DNA by sequencing the coding region of the gene. RESULTS: Classical RS was seen in 68% of the patients. Pathogenic point mutations were found in 64.1% of all patients and in 70.42% of those with the classical phenotype. Four new sequence variations were found, and their nature suggests patogenicity. Genotype-phenotype correlations were performed. CONCLUSION: Detailed clinical descriptions and identification of the underlying genetic alterations of this Brazilian RS population add to our knowledge of genotype/phenotype correlations, guiding the implementation of mutation searching programs.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

With a view toward investigating the feeding behavior of Culicidae mosquitoes from an area of epizootic yellow fever transmission in the municipalities of Garruchos and Santo Antônio das Missões, Rio Grande do Sul State, Brazil, specimens were collected by aspiration from September 2005 to April 2007. The engorged females were submitted to blood meal identification by enzyme-linked immunosorbent assay (ELISA). A total of 142 blood-engorged samples were examined for human or monkey blood through species-specific IgG. Additional tests for specificity utilizing isotypes IgG1 and IgG4 of human monoclonal antibodies showed that only anti-human IgG1 was effective in recognizing blood meals of human origin. The results indicated a significant difference (p = 0.027) in detection patterns in samples of Haemagogus leucocelaenus recorded from human blood meals at Santo Antônio das Missões, which suggests some degree of exposure, since it was an area where epizootic outbreaks have been reported.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Feline Immunodeficiency Virus is a worldwide infection and is considered a significant pathogen. The diagnosis of FIV infections is mainly based on commercially available rapid tests that are highly expensive in Brazil, hence it is rarely performed in the country. Furthermore, lentiviruses grow slowly and poorly in tissue cultures, making the production of viral antigen by classic means and thus the establishment of FIV immunodiagnosis impracticable. In order to deal with this, recombinant DNA techniques were adopted to produce the protein p24, a viral capsid antigen. The protein's reactivity evaluation analyzed by Western blot indicated that this recombinant antigen can be a useful tool for the immunodiagnostic of FIV infections.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Rotavírus é uma das causas mais comuns de diarréia tanto em humanos quanto em diferentes espécies animais. Foi conduzido um estudo transversal a partir de 144 amostras fecais diarréicas colhidas de leitões, provenientes de 16 criações comerciais distribuídas por 10 municípios do Estado de São Paulo, Brasil, com o objetivo de se detectar a ocorrência de rotavírus e realizar sua caracterização molecular quanto seus genotipos G e P. Um total de 43 amostras (29,86%) foram positivas para rotavírus por Eletroforese em Gel de Poliacrilamida (PAGE) e ELISA, num esquema de triagem em paralelo. A caracterização mediante reações do tipo nested-multiplex RT-PCR demonstrou que, isoladamente, o genotipo P[6] foi o mais frequente, detectado em 25,58% das amostras, seguido pelo P[1] (11,63%) e P[7] (9,3%). Infecções concomitantes de genotipos P[6]+P[7] (9,3%), P[1]+P[6] (4,65%), P[1]+P[6]+P[7] (2,33%) foram também observadas. Analogamente, o genotipo G[5] foi detectado em 30,23% das amostras, seguido pelo G[10] (20,93%) e G[6] (4,65%) e G[5]+G[10] (18,6%). O genotipo G[5]P[6] foi o mais frequente (11,63%), porém outras combinações e amostras não tipificáveis também foram observadas. Considerando-se a diversidade de rotavírus suínos encontrada na população estudada, medidas profiláticas específicas devem levar em conta, para sua efetividade, o grau de proteção cruzada entre os genotipos presentes nas formulações vacinais e aqueles que realmente são circulantes numa região.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Rabies is a viral zoonotic infectious disease that affects mammals and is caused by genotypes/species of the Lyssavirus genus (Rhabdoviridae, Mononegavirales), with the genotype 1 (classic rabies virus - RABV) being the most prevalent. Despite continuous efforts, rabies is still an incurable disease that causes thousands of deaths amongst humans worldwide. Due to a wide range of hosts and the different evolutionary paths of RABV in each host, several host-specific variants have arisen in an ongoing process. The result of RABV replication in nervous tissues may lead to two opposite clinical outcomes, i.e., paralytic/dumb form and encephalitic/furious one. The paralytic form creates dead-end hosts mainly amongst herbivores, while the furious form of the disease allows for augmented transmission when manifested in gregarious carnivores, as their natural aggressive behavior is accentuated by the disease itself. The aim of this article is to propose a theoretical model intended to explore how the rabies virus intrinsically modulates the immune system of different host classes, the pathological changes that the virus causes in these animals and how these elements favor its own perpetuation in nature, thus providing a basis for better prediction of the patterns this disease may present.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Nucleotide sequence analyses of the SH gene of 18 mumps virus isolates collected in the 2006-2007 parotitis epidemic in the state of São Paulo identified a new genotype, designated genotype M. This new designation fulfills all the parameters required to define a new mumps virus genotype. The parameters were established by an expert panel in collaboration with the World Health Organization (WHO) in 2005. This information will enhance the mumps virus surveillance program both at the national and global levels

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Acid soils comprise up to 50% of the world's arable lands and in these areas aluminum (Al) toxicity impairs root growth, strongly limiting crop yield. Food security is thereby compromised in many developing countries located in tropical and subtropical regions worldwide. In sorghum, SbMATE, an Al-activated citrate transporter, underlies the Alt(SB) locus on chromosome 3 and confers Al tolerance via Al-activated root citrate release. Methodology: Population structure was studied in 254 sorghum accessions representative of the diversity present in cultivated sorghums. Al tolerance was assessed as the degree of root growth inhibition in nutrient solution containing Al. A genetic analysis based on markers flanking Alt(SB) and SbMATE expression was undertaken to assess a possible role for Alt(SB) in Al tolerant accessions. In addition, the mode of gene action was estimated concerning the Al tolerance trait. Comparisons between models that include population structure were applied to assess the importance of each subpopulation to Al tolerance. Conclusion/Significance: Six subpopulations were revealed featuring specific racial and geographic origins. Al tolerance was found to be rather rare and present primarily in guinea and to lesser extent in caudatum subpopulations. Alt(SB) was found to play a role in Al tolerance in most of the Al tolerant accessions. A striking variation was observed in the mode of gene action for the Al tolerance trait, which ranged from almost complete recessivity to near complete dominance, with a higher frequency of partially recessive sources of Al tolerance. A possible interpretation of our results concerning the origin and evolution of Al tolerance in cultivated sorghum is discussed. This study demonstrates the importance of deeply exploring the crop diversity reservoir both for a comprehensive view of the dynamics underlying the distribution and function of Al tolerance genes and to design efficient molecular breeding strategies aimed at enhancing Al tolerance.