Efeito das interações hiperconjugativas na constante de acoplamento ¹J CH da hexametilenotetramina e do adamantano: estudo teórico e experimental

The objective of this work was to determine the influence of hyperconjugative interactions on the ¹J CH coupling constant for hexamethylenetetramine (1) and adamantane (2). For this end, theoretical and experimental ¹J CH were obtained and hyperconjugative interactions were investigated using NBO. It was observed, theoretically and experimentally, that ¹J CH in 1 is 20 Hz larger than in 2, mainly due to the nN®s*C-H hyperconjugative interaction. This interaction occurs only in 1, with an energy of 9.30 kcal mol-1. It increases the s-character of the carbon atom in the C-H bond and the occupancy of the sigma*C-H orbital in (1).

Germinação de esporos de Polypodium pleopeltifolium: resultados preliminares

Polypodium pleopeltifolium is an epiphytic fern which occurs in cerrado vegetation of the State of São Paulo, Brazil. The species is light sensitive for germination but some spores germinate in the absence of light. Short treatments at 40 or 5ºC and alternating temperatures did not increase the germination in dark conditions. Germination was not affected by IAA but it was reduced by GA3, CEPA and ABA. Red light (short treatments) promoted germination.

Fisionomia e organização da vegetação do carrasco no planalto da Ibiapaba, estado do Ceará

Is the carrasco on the Ibiapaba plateau a unique plant formation? To answer this question the vertical height (except of climbers) and the stem basal diameter (from 3cm on) of woody plants were measured, and soil extracts (0-50 and 50-100cm depth) were taken from 100 random plots (10x10m) at Jaburuna (3º54'34S and 40º59'24W, altitudes near 830m), municipality of Ubajara, Ceará State. Data on climate, soil, diameter height, density, basal area, and physiognomy were compared with those surveyed by other researchers from the carrasco, caatinga, and cerrado in Northeastern Brazil. The carrasco occurs under an annual rainfall of between 668 and 1,289mm and temperatures from 22 to 24ºC, on alic Quartz Sand soils, at altitudes between 700 and 900m: it has a larger density and a smaller basal area than the caatinga and the cerrado, small and similar diameters, and an average vertical height between 3,7 and 5,4m. It differs from the caatinga, cerrado (and cerradão) and secondary forest in many items of lhe ecotope, organization and physiognomy, thus being a unique plain formation, which can be characterized as a deciduous, high, closed, and unistratified shrubland intermingled by lianas, with an irregular canopy and sparse, emergent trees.

Morfoanatomia da raiz tuberosa de Vernonia oxylepis Sch. Bip. in Mart. ex Baker - Asteraceae

Several native herbaceous and subshrub species native to the Cerrado in Brazil are geophytes, that is, they survive the unfavorable dry season and low temperatures, that sometimes coincide with fire, with only the underground system intact. Vernonia oxylepis is one of these species and the aim of this study was to describe the morpho-anatomy of the tuberous root and bud formation on this structure. The main axis of this root is perpendicular to the soil surface, and from which aerial shoots arise periodically throughout the life cycle. On the upper portion of the root, self-grafting of the shoots occurs. The root stores lipids and fructans, exhibits contraction and produces reparatory buds; adventitious buds arise from proliferated pericycle. These characteristics may be related to adaptation of this species to conditions in the Cerrado.

Caracterização morfoanatômica e histoquímica de Cuphea carthagenensis (Jacq.) J.f. Macbr. (Lythraceae)

Cuphea carthagenensis (Jacq.) J.F. Macbr. is an herb, which occurs preferably in wet places. Amongst other species of the genus, C. carthagenensis is distinguished for its great chemical potential and frequent use in popular medicine. In this study the morphological and anatomical structures were identified, as well as the histochemical characterization was done. Samples of root, stem and leaves were collected from adult plants. This material was processed for anatomical and histochemical analysis in light microscopy and for morphological analysis, in scanning electron microscopy. Important morphological and anatomical considerations were added for C. carthagenensis, such as: the occurrence of aerenchymatous phellem with suberized layers; the types of trichomes present in the vegetative organs, the characterization of secretory trichomes, as well as the secreted substances. The groups of secondary metabolites presents in the root, stem and leaf of C. carthagenensis with more intense histochemical reaction were: proanthocyanidins, phenolic compounds, acids polysaccharides (mucilage especially) and lipids.

Revisão taxonômica de Leptolobium (Papilionoideae, Leguminosae)

This revision of Leptolobium Vogel includes an identification key, descriptions, illustrations, and distribution maps for the taxa. Leptolobium comprises 12 species, and is characterized by its arboreal or shrubby habit, flowers with white, actinomorphic or slightly zygomorphic corollas, 10 free stamens, a stipitate ovary with many ovules, indehiscent (samara-like or nut-like) fruits, compressed seeds, and a bulbose hypocotyl-radicle axis. Leptolobium is a neotropical genus that occurs from Mexico to northern Argentina. Eleven species are found in Brazil, seven of which are endemic to the country. The lectotype of Sweetia glazioviana Harms is designated in this paper. In addition, information about uses, common names, geographical distribution, and habitats are provided.

Revisão taxonômica de Lonchocarpus s. str. (Leguminosae, Papilionoideae) do Brasil

A revision of the Brazilian species of Lonchocarpus s. str. is presented. This study is based on field observation and an analysis of approximately 1,200 herbarium collections. Nine species are recognized, L. cultratus, L. hedyosmus, L. latifolius, L. macrocarpus, L. nitidus, L. pluvialis, L. sericeus, L. spiciflorus, and L. violaceus, which grow in forests and are usually associated with river banks. Lonchocarpus sericeus and L. cultratus have a wide distribution throughout Brazil, whereas L. hedyosmus, L. macrocarpus, L. spiciflorus, and L. latifolius are restricted to the Amazonian domain. Lonchocarpus pluvialis occurs in the Central-West (Mato Grosso do Sul and Goiás) and Southeast (São Paulo) regions. Lonchocarpus violaceus is found in the states of Bahia and Espírito Santo, and is reported for the first time for Brazil. Identification keys, descriptions, and illustrations, in addition to information about habitat, geographic distribution and taxonomic and nomenclatural comments, are provided for the species. Four new synonyms and five lectotypifications are proposed.

Movimentos sociais na contemporaneidade

The work aims to present an overview of social movements in actuality, in the Latin America, and presents a mapping of their main forms in Brazil. The search ponders the educational character of their actions, both for its participants, as for society in general and public agencies. The basic premise of assertion that social movements are sources of innovation and knowledge-generating arrays. However, because it is not an isolated process but social-political character, the paper search joints in the network of relationships that establish movements in political, economic and socio-cultural country, to understand the factors that generate learning built and values of political culture that are being built. . The text highlights movements that occurs in the areas of education - formal and non-formal education.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Thyroid nodules and differentiated thyroid cancer: update on the Brazilian consensus

Thyroid nodules are frequent findings, especially when sensitive imaging methods are used. Although thyroid cancer is relatively rare, its incidence is increasing, particularly in terms of small tumors, which have an uncertain clinical relevance. Most patients with differentiated thyroid cancer exhibit satisfactory clinical outcomes when treatment is appropriate, and their mortality rate is similar to that of the overall population. However, relapse occurs in a considerable fraction of these patients, and some patients stop responding to conventional treatment and eventually die from their disease. Therefore, the challenge is how to identify the individuals who require more aggressive disease management while sparing the majority of patients from unnecessary treatments and procedures. We have updated the Brazilian Consensus that was published in 2007, emphasizing the diagnostic and therapeutic advances that the participants, representing several Brazilian university centers, consider most relevant in clinical practice. The formulation of the present guidelines was based on the participants' experience and a review of the relevant literature.

Central retinal vein thrombosis as an initial manifestation of heterozygous protein C deficiency: case report

The purpose of this paper is to report a case of central retinal vein thrombosis associated with isolated heterozygous protein C deficiency. Acute occlusion of the central retinal vein presents as one of the most dramatic pictures in ophthalmology. It is often a result of both local and systemic causes. A rare systemic cause is heterozygous protein C deficiency, and it usually occurs in combination with other thrombophilic conditions. This case highlights that isolated heterozygous protein C deficiency may be the cause of central retinal vein thrombosis and underscores the importance of its screening in young patients with this ophthalmologic disease.

Procurando o lazer no Constituinte : sua inclusão como direito social na Constituição de 1988

Universidade Estadual de Campinas . Faculdade de Educação Física

As conferências nacionais do esporte na configuração da política esportiva e de lazer no governo Lula (2003-2010)

Universidade Estadual de Campinas . Faculdade de Educação Física

Praticas socioculturais, poder e diferenciação em Bico, Cuiamucu e Canela-Fina - comunidades amazonicas

Universidade Estadual de Campinas . Faculdade de Educação Física

A aula de educação fisica como reprodutora de estereotipos de genero a luz da experiencia no Colegio "Inem Santiago Perez" : Santa-Fé de Bogota-Colombia

Universidade Estadual de Campinas . Faculdade de Educação Física