1000 resultados para MOSQUITOS DIPTERA


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Aedes (Stegomyia) aegypti is a species of mosquitoes known to be the vector of diseases such as dengue and yellow fever, and a better understanding of aspects of their biology can help in the establishment of control strategies for the same. Several previous studies showed that temperature significantly affects the development of immature stages of insects. In general, higher temperatures (up to a threshold) accelerate the development of insects, and lower temperature retards the same. This rule also applies to mosquitoes, including Ae. aegypti. But not still know the effects of daily variation of temperature on the developmental stages of mosquitoes. And this detail is very important, since in natural breeding or artificial, The mosquitoes usually face temperature variations over a single day, which should interfere with its development until the emergence of the adult forms. For this reason, the objective of this study is to analyze the effect of alternating temperatures on the development of Ae. aegypti. To conduct the study, adults were collected active in the neighborhood Bela Vista Campus of UNESP - Rio Claro, SP, using a sweep net or using ovitraps for immatures, and the active search for breeding. Individuals collected were kept under experimental conditions in the laboratory. The adult samples were identified to species level, were considered for the experiments, only samples of Ae. aegypti. The insects were housed in plastic cages, suitable for creating flies. These were fed with sugar solution and blood meal on alternate days. The eggs obtained were used in the experiment with four different temperature regimes. The data collected were analyzed by evaluating whether the different treatments influenced the development of immature to adult, performing the Kruskal-Wallis test and the statistical software BioEstat. Statistical analysis of the sex ratio... (Complete abstract click electronic access below)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Aedes aegypti, mosquito da família Culicidae responsável pela transmissão dos vírus da dengue, da febre amarela urbana e da febre chikungunya, apresenta grande proliferação em áreas urbanas das regiões tropicais e subtropicais, além de representar um fator de incômodo por causar alergias devido à inoculação dos componentes salivares durante o processo do repasto sanguíneo. Como forma de evitar os problemas causados por eles, o repelente mais usado e registrado comercialmente desde 1957 é o DEET (N,N-dietil-3-metilbenzamida ou N,N-dietil-meta-toluamida), que apesar de apresentar eficácia comprovada possui determinada toxicidade quando utilizado por crianças e por mulheres grávidas ou lactantes. Atualmente, grande parte dos estudos sobre novas substâncias repelentes envolvem óleos essenciais de plantas, principalmente por serem atóxicos, biodegradáveis, possuírem um preço mais acessível e uma ampla atividade contra diferentes espécies de mosquitos. Os terpenos 1,8-cineol, β-cariofileno e α-humuleno podem ser encontrados em óleos essenciais de uma grande variedade de plantas e apesar de dados da literatura mostrarem uma eficácia dessas substâncias como repelentes para outras espécies de insetos, até o presente momento não existem estudos que relacionam porcentagem de repelência ao longo do tempo para avaliar o potencial de repelência das mesmas para culicídeos.O presente estudo avaliou tais substâncias como possíveis repelentes para A. aegypti, utilizando o DEET como controle positivo. Para avaliar a eficácia do β-cariofileno foi utilizada a BG-cage, uma gaiola desenvolvida especificamente para testes de repelência onde o voluntário expõe um braço sob uma abertura coberta por uma tela onde os mosquitos pousam, mas não picam. Os testes foram repetidos a cada 30 minutos após a aplicação do produto por um tempo máximo de duas horas (seguindo a recomendação de reaplicação do produto comercial ...

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: The most substantial and best preserved area of Atlantic Forest is within the biogeographical sub-region of Serra do Mar. The topographic complexity of the region creates a diverse array of microclimates, which can affect species distribution and diversity inside the forest. Given that Atlantic Forest includes highly heterogeneous environments, a diverse and medically important Culicidae assemblage, and possible species co-occurrence, we evaluated mosquito assemblages from bromeliad phytotelmata in Serra do Mar (southeastern Brazil). Methods: Larvae and pupae were collected monthly from Nidularium and Vriesea bromeliads between July 2008 and June 2009. Collection sites were divided into landscape categories (lowland, hillslope and hilltop) based on elevation and slope. Correlations between bromeliad mosquito assemblage and environmental variables were assessed using multivariate redundancy analysis. Differences in species diversity between bromeliads within each category of elevation were explored using the Renyi diversity index. Univariate binary logistic regression analyses were used to assess species co-occurrence. Results: A total of 2,024 mosquitoes belonging to 22 species were collected. Landscape categories (pseudo-F value = 1.89, p = 0.04), bromeliad water volume (pseudo-F = 2.99, p = 0.03) and bromeliad fullness (Pseudo-F = 4.47, p < 0.01) influenced mosquito assemblage structure. Renyi diversity index show that lowland possesses the highest diversity indices. The presence of An. homunculus was associated with Cx. ocellatus and the presence of An. cruzii was associated with Cx. neglectus, Cx. inimitabilis fuscatus and Cx. worontzowi. Anopheles cruzii and An. homunculus were taken from the same bromeliad, however, the co-occurrence between those two species was not statistically significant. Conclusions: One of the main findings of our study was that differences in species among mosquito assemblages were influenced by landscape characteristics. The bromeliad factor that influenced mosquito abundance and assemblage structure was fullness. The findings of the current study raise important questions about the role of An. homunculus in the transmission of Plasmodium in Serra do Mar, southeastern Atlantic Forest.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A description of Anopheles (Cellia) irenicus Schmidt, sp.n. (formerly A. farauti No. 7) is provided. This species is one of six recorded from the Solomon Islands within the A. punctulatus group, which contains the major vectors of the causative agents of malaria and lymphatic filariasis in the southwest Pacific. Morphological markers are described for adult females, fourth-instar larvae and pupae that identify most specimens of A. irenicus. Keys are presented to distinguish members of the A. punctulatus group in the Solomon Islands.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A new United States (U.S.) self-supporting low-profile bednet was designed by Walter Reed Army Institute of Research in collaboration with Breakthrough Technologies. The bednet incorporated permethrin-impregnated screening into a frame that erected automatically when removed from its bag. The new U.S. bednet was compared with the current Australian Defense Force (ADF) mosquito bednet at Buka Island, North Solomons Province, Papua New Guinea, in March 1999. At the time of the test, Anopheles farauti Laveran was the most abundant biting mosquito. Both bednet types provided > 97.8% protection compared with an unprotected collector. The untreated U.S. Army prototype bednet provided better protection than the untreated ADF bednet against mosquitoes entering the bednet during the night.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Species identification is an essential step in the progress and completion of work in several areas of biological knowledge, but it is not a simple process. Due to the close phylogenetic relationship of certain species, morphological characters are not always sufficiently distinguishable. As a result, it is necessary to combine several methods of analysis that contribute to a distinct categorization of taxa. This study aimed to raise diagnostic characters, both morphological and molecular, for the correct identification of species of the genus Chrysomya (Diptera: Calliphoridae) recorded in the New World, which has continuously generated discussion about its taxonomic position over the last century. A clear example of this situation was the first record of Chrysomya rufifacies in Brazilian territory in 2012. However, the morphological polymorphism and genetic variability of Chrysomya albiceps studied here show that both species (C. rufifacies and C. albiceps) share very similar character states, leading to misidentification and subsequent registration error of species present in our territory. This conclusion is demonstrated by the authors, based on a review of the material deposited in major scientific collections in Brazil and subsequent molecular and phylogenetic analysis of these samples. Additionally, we have proposed a new taxonomic key to separate the species of Chrysomya found on the American continent, taking into account a larger number of characters beyond those available in current literature.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In insects that utilize patchy and ephemeral resources for feeding and egg laying, the outcome of larval competition for food resources depends on the amount of resources and the spatial distribution of immatures among patches of food. In the present study, the results of larval competition for food in Chrysomya megacephala, in traits such as female weight, fecundity and reproductive investment, were different in situations where the level of larval aggregation (proportion of competitors per amount of food) was the same, but with densities of competitors and amounts of food proportionally different. These results are indicative that the larval competition may depend both on the larval density and the amount of food, in different situations with the same proportion of larvae per gram of food.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A catalogue is provided with the type material of four superfamilies of "Acalyptrate" (Conopoidea, Diopsoidea, Nerioidea and Tephritoidea) held in the collection of the Museu de Zoologia da Universidade de São Paulo (MZUSP), São Paulo, Brazil. Concerning the taxa dealt with herein, the Diptera collection of MZUSP held 77 holotypes, 4 "allotypes" and 194 paratypes. In this paper, information about data labels, preservation and missing structures of the type specimens is given.