994 resultados para Jorge Ferreira de Vasconcelos
Resumo:
Dissertação para obtenção do Grau de Mestre em Engenharia do Ambiente, Perfil de Ordenamento do Território e Impactes Ambientais
Resumo:
Timber frame buildings are well known as an efficient seismic resistant structure popular all over the world not only due to their seismic performance, but also to their low cost and the strength they offer. These constructions still exist today and it is important to be able to preserve them, so a better knowledge on their behaviour is sought. Furthermore, historic technologies could be used even in modern constructions to build seismic resistant buildings using more natural materials with lesser costs. A great rehabilitation effort is being carried out on this type of buildings, as their neglect has led to decay or their change in use and alterations to the structure has led to the need to retrofit such buildings; only recently studies on their behaviour have become available and only a few of them address the issue of possible strengthening techniques for this kind of walls. In this scope, an innovative retrofitting technique (near surface mounted steel flat bars) is proposed and validated on traditional timber frame walls based on an extensive experimental program. The results of the static cyclic tests on distinct wall typologies retrofitted with the NSM technique are herein presented and discussed in detail. The main features on deformation, lateral stiffness, lateral resistance and seismic performance indexes are analysed
Resumo:
Objective To aprehend the social representations about the solvability in mental health care with users of the Family Health Strategy and professionals of family health teams and of the Center for Psychosocial Care. Method A qualitative study using semi-structured interviews for data collection, and the Alceste software for analysis. This software uses the Hierarchical Descending Classification based on the examination of lexical roots, considering the words as units and providing context in the corpus. Results The representations emerge in two opposing poles: the users require satisfaction with care and the professionals realize the need for improvement of health actions. Although the matricial support in mental health and the home visits are developed, the barriers related to investment in health, continuing education and organization of care persist. Conclusion The different representations enable improvements in customer service, solvability of care and aggregate knowledge and practices in the expanded perspective of health needs in the family, social and therapeutic context.
Resumo:
AbstractIntroduction/objective:We evaluated the predictability of early changes in serum albumin (sAlb) on the two-year mortality of incident hemodialysis patients.Methods:Observational, longitudinal retrospective study using the database of Fresenius Medical Care of Latin America. Adult patients starting dialysis from January/2000 to June/2004, from 25 centers were included. Changes in sAlb during the first 3 months on hemodialysis were used as the main predictor. The outcome was death from any cause.Results:1,679 incident patients were included. They were 52 ± 15 years old, 58.7% male and 21.5% diabetic, with a median sAlb of 38 g/L (bromocresol green). 923 patients had sAlb < 38 g/L (Low sAlb Group) and 756 ones had sAlb > 38.0 g/L (Adequate sAlb Group). The mortality was significantly higher in Low sAlb Group (17% vs. 11%, p < 0.001). Early changes in sAlb significantly affected two-year mortality. Factoring the Kaplan Meier curve of Low sAlb Group by the presence of an increase in sAlb uncovered of a statistically significant difference in mortality favoring the ones whose sAlb went up (19% vs. 15%, p = 0.043). Differently, patients from Adequate sAlb Group with a decrease in their sAlb had a statistically higher mortality rate (13% vs. 8%, p = 0.029).Conclusions:Early sAlb changes showed a significant predictive power on mortality at 2 years in incident hemodialysis patients. Those with low initial sAlb may have a better prognosis if their sAlb rises. In contrast, patients with satisfactory initial levels can have a worsening of their prognosis in the case of an early reduction in sAlb.
Resumo:
Esta investigación busca demostrar cómo las estrategias comunicativas no verbales, empleadas por Gaitán, influyeron de manera positiva en su discurso político. Así, el dominio consciente e inconsciente de elementos no verbales funciona estratégicamente para complementar su discurso.
Resumo:
Establecer un marco teórico adecuado para insertar las diferentes causas-medios y fines del hecho educativo, de los temas que se tratan. Proporcionar un modelo metodológico válido de reflexión pedagógica, mediante la combinación de elementos literarios y educativos. Ofrecer a través de guías bibiográficas concretas una serie de referncas para una mayor selección de los temas seleccionados. . Obra literaria de José Mauro de Vasconcelos. . Reflexión psicopedagógica. . Obra literaria del autor brasileño, 18 de las 20 , más un pequeño cuento de viñetas que componen su producción novelística, realizando un estudio más minucioso de tres novelas que forman una trilogía educativa: ' Mi planta de naranja-lima', ' Vamos a calentar el sol' y ' Doidao'.. Ha sido una primera lectura de la trilogía educativa de Vasconcelos, el marco inicial para precisar el perímetro en torno a la ordenación, sistematización de los diferentes aspectos educativos, implícitos en la trilogía de las novelas estudiadas. Su labor pedagógica se centra en síntesis y equilibrio, para ello es necesario el establecer en el proceso educativo una división sistematizada. Problemas relativos a la educación que se plantea el pedagogo ante la realidad del quehacer educativo: 1. Básicos: son los que condicionana y aseguran la existencia de las cuestiones centrales y de las derivadas, estos son: el concepto de educación, la posibilidad de la educación, necesidad de la educación, legitimidad de la educación, los límites de la educación. 2. Centrales: son aquellos que surgen y plantean, en la dinámica misma del proceso educativo sistemático y que aseguran, cuando se resuelve la realización de este proceso; estos son: El problema de los fines o teleología educativa, el de los medios o problema mesológico, el sujeto de la educación o educando, el de los agentes de la educación: individualmente el educador, colectivamente las sociedades educadoras. 3. Derivados: Este apartado agrupa cuestiones de tipo secundario. Son aquellos que se constituyen alrededor de la Pedagogía Tecnológica..
Resumo:
Pautado nessa perspectiva de valorização do patrimônio industrial na região do ABC, esse texto volta-se para as relações entre indústria, lazer e memória. Tem como foco o tema do lazer e do entretenimento como uma das construções patrimoniais da sociedade industrial. O Palácio de Mármore do Moinho São Jorge representa um caso em que tais relações se conjugam. Dessa forma, propõe-se com esse artigo, apontar as relações existentes entre industrialização e lazer no ABC no período de 1950/60, tomando como ponto de partida as lembranças das pessoas que viveram à época.
Resumo:
Chromobacterium violaceum is one of millions of species of free-living microorganisms that populate the soil and water in the extant areas of tropical biodiversity around the world. Its complete genome sequence reveals (i) extensive alternative pathways for energy generation, (ii) ≈500 ORFs for transport-related proteins, (iii) complex and extensive systems for stress adaptation and motility, and (iv) wide-spread utilization of quorum sensing for control of inducible systems, all of which underpin the versatility and adaptability of the organism. The genome also contains extensive but incomplete arrays of ORFs coding for proteins associated with mammalian pathogenicity, possibly involved in the occasional but often fatal cases of human C. violaceum infection. There is, in addition, a series of previously unknown but important enzymes and secondary metabolites including paraquat-inducible proteins, drug and heavy-metal-resistance proteins, multiple chitinases, and proteins for the detoxification of xenobiotics that may have biotechnological applications.
Resumo:
O estudo da novela "Uma estória de amor", de Guimarães Rosa (1908-1967), que pretendemos desenvolver na realização desta Dissertação de Mestrado, traz como principal mote a recepção crítica e a interpretação das cantigas, narrativas e estórias cantadas e contadas durante a "Festa de Manuelzão" (espécie de subtítulo de "Uma estória de amor"). Desse modo, nosso trabalho terá sua metodologia desenvolvida com fundamento na Estética da Recepção, formulada por Hans Robert Jauss (1921-1997), porém, não se trata de amparar a feitura dessa Dissertação, única e exclusivamente, nos métodos estético-recepcionais, mas, de amparados pelos estudos hermenêuticos, sobretudo os formulados por Jauss, constituir um cenário possível para a obra de Guimarães Rosa, considerando suas várias interpretações e sua importância para a afirmação do caráter vanguardista atribuído ao seu legado, em especial à "Uma estória de amor". Durante a realização da festa que marcará a inauguração da fazenda, os muito contadores e cantadores chegam à Samarra (propriedade de Federico Freire, patrão de Manuelzão) com a missão de contar narrativas e cantigas que conduzirão o velho vaqueiro a um raro momento de parada dos seus afazeres na fazenda, levando-o a fazer parte da celebração de sua festa. Com vista a realizar o objetivo proposto nesta Dissertação, sua divisão estrutura-se na construção de três capítulos, sendo cada um, subdividido em duas partes. Tal divisão há de servir ao alcance das questões, conclusões e possibilidades interpretativas sobre "Uma estória de amor". Assim é que, já no primeiro capítulo do texto, explorar-se-á a recepção crítica de "Uma estória de amor", bem como seu caráter vanguardista, tomando como exemplo a Literatura oral, que torna a novela de Guimarães Rosa objeto mais do que suficiente aos estudos propostos por Jauss. No segundo capítulo, dissertar-se-á sobre o amor, segundo a discussão empreendida por Derrida acerca do phármakon, teorizado em A farmácia de Platão (1991), como recorrência, ao mesmo tempo, desencadeadora de um veneno e de um poder curativo, que atribuem, ao protagonista da novela em questão, o papel do ouvinte ainda capaz de se emocionar e surpreender-se com a simples audição de relatos, aparentemente tão ingênuos sobre estórias adquiridas e perpassadas ao longo dos anos pela oralidade. No capítulo final, intenta-se realizar uma análise de alguns cantos, e, especificamente, de três narrativas condicionadas em "Uma estória de amor", dialogando com leituras mais recentes da obra (Sandra Vasconcelos, em Puras Misturas [1997], por exemplo), para demonstrar a importância do relato transmitido pelas várias gerações que procedem à narrativa original, as quais, indiferente às mudanças de rumo constantes nesses possíveis textos, muitas vezes, parecem discordar do original.
Resumo:
A doença de Jorge Lobo é uma micose rara de inflamação crônica que provoca lesão na pele sem disseminação visceral. Essa doença é causada pelo fungo Lacazia loboi. Sua ocorrência é predominante em regiões de clima quente e úmido, sendo a maior parte dos casos registrados na região Amazônica brasileira. As observações histopatológicas mostram grande quantidade de fungos no local da lesão, havendo um rico infiltrado macrófagico, com presença de células gigantes e limitada presença de linfócitos. A migração de leucócitos para o sítio inflamatório induzida por Lacazia loboi é supostamente coordenada por citocinas e quimiocinas que auxiliadas por vasos sanguíneos e linfáticos influencia a migração celular induzindo a expressão de moléculas de adesão. No presente trabalho investigamos possíveis alterações microvasculares associadas à infecção por Lacazia loboi no local da lesão que podem interferir na evolução dos aspectos clínicos dos pacientes. Dessa forma, avaliamos a densidade dos vasos sanguíneos e linfáticos, bem como a expressão das moléculas ICAM-1, VCAM-1 e E-selectina. Nossos resultados mostraram que na doença de Jorge Lobo, há uma reduzida quantidade de vasos sanguíneos e linfáticos, quando comparado a pele controle. Houve um maior número de vasos expressando ICAM-1, sendo também observado maior número de vasos expressando a molécula VCAM-1, embora em quantidade menos proeminente que ICAM-1. Não observamos diferença na expressão de E-selectina. Juntos nos resultados apontam para uma alteração na microvasculatura local o que pode interferir no desenvolvimento de uma resposta imune celular eficiente e justificar a presença do fungo limitada ao local da lesão.
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
The hospitalization process can cause significant changes in the children’s everyday life because, besides the suffering caused by the disease, there are the invasive processes which bring them sorrow. Thus, aiming to make this state of sorrow lower and to contribute for the treatment process we developed in a hospital the Mobile Toy Library project which develops interactive activities through playing, trying to make the staying of these kids at the hospital easier. The team is formed by Psychology professors and students, who daily visit the children with a trolley full of toys in order to interact and play with them. We wait on 500 patients a year. We concluded the Mobile Toy Library provides ways for kids to elaborate their psychological conflicts, lowering their sorrow as well as their negative feelings of staying in hospital, and this helps them deal with the disease, family and medical team all together.
Resumo:
Background: Acute respiratory distress syndrome (ARDS) is associated with high in-hospital mortality. Alveolar recruitment followed by ventilation at optimal titrated PEEP may reduce ventilator-induced lung injury and improve oxygenation in patients with ARDS, but the effects on mortality and other clinical outcomes remain unknown. This article reports the rationale, study design, and analysis plan of the Alveolar Recruitment for ARDS Trial (ART). Methods/Design: ART is a pragmatic, multicenter, randomized (concealed), controlled trial, which aims to determine if maximum stepwise alveolar recruitment associated with PEEP titration is able to increase 28-day survival in patients with ARDS compared to conventional treatment (ARDSNet strategy). We will enroll adult patients with ARDS of less than 72 h duration. The intervention group will receive an alveolar recruitment maneuver, with stepwise increases of PEEP achieving 45 cmH(2)O and peak pressure of 60 cmH2O, followed by ventilation with optimal PEEP titrated according to the static compliance of the respiratory system. In the control group, mechanical ventilation will follow a conventional protocol (ARDSNet). In both groups, we will use controlled volume mode with low tidal volumes (4 to 6 mL/kg of predicted body weight) and targeting plateau pressure <= 30 cmH2O. The primary outcome is 28-day survival, and the secondary outcomes are: length of ICU stay; length of hospital stay; pneumothorax requiring chest tube during first 7 days; barotrauma during first 7 days; mechanical ventilation-free days from days 1 to 28; ICU, in-hospital, and 6-month survival. ART is an event-guided trial planned to last until 520 events (deaths within 28 days) are observed. These events allow detection of a hazard ratio of 0.75, with 90% power and two-tailed type I error of 5%. All analysis will follow the intention-to-treat principle. Discussion: If the ART strategy with maximum recruitment and PEEP titration improves 28-day survival, this will represent a notable advance to the care of ARDS patients. Conversely, if the ART strategy is similar or inferior to the current evidence-based strategy (ARDSNet), this should also change current practice as many institutions routinely employ recruitment maneuvers and set PEEP levels according to some titration method.
Resumo:
Después de que Carlos Vaz Ferreira inaugurara en el Uruguay una nueva forma de hacer filosofía, hacia 1910, fecha de publicación de su Lógica viva, un puñado de profesores, filósofos y pensadores, discípulos o seguidores de la generación siguiente, se sintió fuertemente atraído por el fervor de una nueva lógica naciente. Este fervor, por otra parte, atrapaba a los filósofos europeos en la misma época.
Resumo:
Mapeamento das dissertações e teses referentes à subárea da comunicação popular, alternativa e comunitária (CPAC) desenvolvidas nos Programas de Pós-Graduação em Comunicação stricto sensu no Brasil, de 1972 a 2012. Dentre os objetivos estão localizar as pesquisas; os autores; sua distribuição no tempo e espaço; identificar as instituições e orientadores que impulsionam a subárea; definir as abordagens teórico-metodológicas; e apontar autores/conceitos referência. Por meio de pesquisa exploratória e aplicação de quatro filtros, chegou-se a uma amostra final de 102 pesquisas, 87 dissertações e 15 teses, submetidas à análise quantitativa, por meio de Análise de Conteúdo a partir de partes pré-definidas (Resumo, Palavras chave, Introdução, Sumário, Considerações Finais e capítulo metodológico, quando presente), e a uma análise qualitativa do conteúdo completo das 15 teses. O método que orienta esta pesquisa é o histórico dialético, na perspectiva da busca de uma análise de conjunto e atenta às contradições e mudanças que o objeto está implicado; e a pesquisa bibliográfica que a fundamenta se ancora em autores como Jorge González, Cicilia Peruzzo, Regina Festa, Pedro Gilberto Gomes, Gilberto Giménez e Augusto Triviños e foi realizada com o apoio do software NVivo. Resultados quantitativos indicam: a) predominância de pesquisas sobre comunicação comunitária (68%) b) predominância de estudos empíricos (79%); c) a variedade de denominações atribuídas às experiências pelos pesquisadores; d) a constante luta das classes populares por democratização da comunicação e por direitos sociais ao longo dos anos; e) a influência e importância dos intelectuais orgânicos nas experiências estudadas, f) problemas metodológicos; g) UMESP, USP e UFRJ como instituições protagonistas, e, h) Cicilia Peruzzo e Raquel Paiva como as que mais orientam teses e dissertações sobre a temática. Quanto à análise qualitativa verificaram-se alguns critérios que permeiam a CPAC: 1) a definição de classes subalternas; 2) a importância da participação ativa das comunidades nos processos de comunicação; e 3) formas, conteúdos e objetivos que se complementam e dão identidade às experiências