986 resultados para Edge Detection
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.
Resumo:
Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.
Resumo:
Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.
Resumo:
To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.
Resumo:
The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.
Resumo:
The naturally occurring clonal diversity among field isolates of the major human malaria parasite Plasmodium vivax remained unexplored until the early 1990s, when improved molecular methods allowed the use of blood samples obtained directly from patients, without prior in vitro culture, for genotyping purposes. Here we briefly review the molecular strategies currently used to detect genetically distinct clones in patient-derived P. vivax samples, present evidence that multiple-clone P. vivax infections are commonly detected in areas with different levels of malaria transmission and discuss possible evolutionary and epidemiological consequences of the competition between genetically distinct clones in natural human infections. We suggest that, when two or more genetically distinct clones are present in the same host, intra-host competition for limited resources may select for P. vivax traits that represent major public health challenges, such as increased virulence, increased transmissibility and antimalarial drug resistance.
Resumo:
Due to the imprecise nature of biological experiments, biological data is often characterized by the presence of redundant and noisy data. This may be due to errors that occurred during data collection, such as contaminations in laboratorial samples. It is the case of gene expression data, where the equipments and tools currently used frequently produce noisy biological data. Machine Learning algorithms have been successfully used in gene expression data analysis. Although many Machine Learning algorithms can deal with noise, detecting and removing noisy instances from the training data set can help the induction of the target hypothesis. This paper evaluates the use of distance-based pre-processing techniques for noise detection in gene expression data classification problems. This evaluation analyzes the effectiveness of the techniques investigated in removing noisy data, measured by the accuracy obtained by different Machine Learning classifiers over the pre-processed data.
Development of instrumentation for amperometric and coulometric detection using ultramicroelectrodes
Resumo:
In this work it is presented the development of a simple, portable and inexpensive instrumentation for amperometric and coulometric detection in different analytical instrumentation systems utilizing ultramicroelectrodes. The software, developed in LabVIEW 7.1TM, is capable to carry out three main detection techniques (amperometric, pulsed amperometric and coulometric detection) and a voltammetric technique (cyclic voltammetry). The instrumentation was successfully evaluated using the following systems: cyclic voltammograms of metallic electrodes in alkaline solutions, flow electrochemical detection of glucose and glycine and direct determination of herbicide glyphosate (electrochemical detection coupled to HPLC).
Resumo:
This paper describes a sequential injection chromatography procedure for determination of picloram in waters exploring the low backpressure of a 2.5 cm long monolithic C18 column. Separation of the analyte from the matrix was achieved in less than 60 s using a mobile phase composed by 20:80 (v v-1) acetonitrile:5.0 mmol L-1 H3PO4 and flow rate of 30 μL s-1. Detection was made at 223 nm with a 40 mm optical path length cell. The limits of detection and quantification were 33 and 137 μg L-1, respectively. The proposed method is sensitive enough to monitor the maximum concentration level for picloram in drinking water (500 μg L-1). The sampling frequency is 60 analyses per hour, consuming only 300 μL of acetonitrile per analysis. The proposed methodology was applied to spiked river water samples and no statistically significant differences were observed in comparison to a conventional HPLC-UV method.
Resumo:
Feline Immunodeficiency Virus is a worldwide infection and is considered a significant pathogen. The diagnosis of FIV infections is mainly based on commercially available rapid tests that are highly expensive in Brazil, hence it is rarely performed in the country. Furthermore, lentiviruses grow slowly and poorly in tissue cultures, making the production of viral antigen by classic means and thus the establishment of FIV immunodiagnosis impracticable. In order to deal with this, recombinant DNA techniques were adopted to produce the protein p24, a viral capsid antigen. The protein's reactivity evaluation analyzed by Western blot indicated that this recombinant antigen can be a useful tool for the immunodiagnostic of FIV infections.
Resumo:
The Indirect Fluorescence Assay (IFA) and the indirect ELISA were comparatively used to detect IgG and IgM antibodies for Toxoplasma gondii in experimentally and naturally infected primates. In the experimentally infected group, antibodies of diagnostic value were detected at day 9 post-infection (PI) with the IFA (IgG and IgM) and with IgG-ELISA. IgM-ELISA detected antibodies for T. gondii starting at day 3 PI until the end of the experiment (102 days PI). Of the 209 naturally infected sera tested, from many zoos of State of Sao Paulo, 64.59 and 67.94% were positive in the IgG-IFA test and IgG-ELISA respectively. IgM-ELISA test detected seropositivity in 52.63% of the sera although IgM-IFA test detected it in only in 0.96% of the samples. The differential toxoplasmosis diagnosis was accomplished with Neospora caninum by IFA, observing 61 (29.2%) seropositive animals for this parasite and 149 (70.8%) negative. Sixty animals were positive for both T. gondii and N. caninum. Pneumonia, splenomegaly, and intestinal ulcers were macroscopically observed. Unremarkable interstitial pneumonia, enteritis, colitis, splenitis, and glomerulitis were microscopically observed. The immunohistochemical stain could not detect the presence of T. gondii in the tissues of the animals infected experimentally.
Resumo:
Bovine coronavirus (BCoV) is a member of the group 2 of the Coronavirus (Nidovirales: Coronaviridae) and the causative agent of enteritis in both calves and adult bovine, as well as respiratory disease in calves. The present study aimed to develop a semi-nested RT-PCR for the detection of BCoV based on representative up-to-date sequences of the nucleocapsid gene, a conserved region of coronavirus genome. Three primers were designed, the first round with a 463bp and the second (semi-nested) with a 306bp predicted fragment. The analytical sensitivity was determined by 10-fold serial dilutions of the BCoV Kakegawa strain (HA titre: 256) in DEPC treated ultra-pure water, in fetal bovine serum (FBS) and in a BCoV-free fecal suspension, when positive results were found up to the 10-2, 10-3 and 10-7 dilutions, respectively, which suggests that the total amount of RNA in the sample influence the precipitation of pellets by the method of extraction used. When fecal samples was used, a large quantity of total RNA serves as carrier of BCoV RNA, demonstrating a high analytical sensitivity and lack of possible substances inhibiting the PCR. The final semi-nested RT-PCR protocol was applied to 25 fecal samples from adult cows, previously tested by a nested RT-PCR RdRp used as a reference test, resulting in 20 and 17 positives for the first and second tests, respectively, and a substantial agreement was found by kappa statistics (0.694). The high sensitivity and specificity of the new proposed method and the fact that primers were designed based on current BCoV sequences give basis to a more accurate diagnosis of BCoV-caused diseases, as well as to further insights on protocols for the detection of other Coronavirus representatives of both Animal and Public Health importance.
Resumo:
Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10ºC and 27ºC) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27ºC and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures.