997 resultados para coeficiente de eficácia protéica
Resumo:
A tuberculose é um problema de saúde pública no Brasil, e apesar de ser uma doença antiga, houve pouca melhora nos seus indicadores. Na última década o coeficiente de incidência apresentou uma redução de 20%. O problema ainda maior ainda está na falta de adesão dos pacientes ao tratamento. O recomendado pela Organização Mundial da Saúde (OMS) é que 85% dos pacientes com a forma pulmonar baculífera cheguem à cura e este índice no Brasil fica em torno de 70%. O tratamento baseia-se na associação de drogas de alta eficácia por um período mínimo de seis meses. A partir da análise realizada com os pacientes atendidos no ambulatório de tuberculose da Unidade Regional de Saúde de Serra Sede foi possível verificar a presença de pacientes em uso irregular da medicação, abandono de tratamento, resistência medicamentosa e recidiva da tuberculose. Baseando-se nessa premissa, o estudo tem por objetivo propor medidas facilitadoras de intervenção frente à maior adesão ao tratamento de tuberculose pulmonar nos pacientes atendidos na Unidade Regional de Saúde da Serra, evitando o abandono do tratamento. Ao aprofundar conhecimentos no assunto, evitam-se medidas desnecessárias, preconceituosas e, às vezes, maléficas; ou seja, contribui-se para fortalecer o tratamento, a cura do paciente e a diminuição da transmissão da doença. Conclui-se que a educação em saúde é um processo baseado na participação das pessoas e na mobilização social, objetivando à mudança de determinada situação, rompendo com o paradigma de educação como transferência de conhecimento, habilidades e destrezas.
Resumo:
Este trabalho tem por objetivo verificar a eficácia da intervenção educativa como método para diminuir complicações cardíacas de hipertensos cadastrados na UBS 705, município de São João Del Rei-MG. O plano de intervenção foi desenvolvido segundo os métodos descrito pelo Planejamento Estratégico Situacional; e para subsidiar a abordagem teórica e construção deste projeto, procedeu-se com revisão narrativa da literatura em bases de dados e documentos do ministério da Saúde. O problema priorizado foi a alta prevalência de Hipertensão Arterial com complicacoes cardiologicas pela baixa adesão e estabeleceu-se como nós críticos: hábitos e estilos de vida inadequados, processo de trabalho da equipe de saúde inadequado, falta de apoio da família, nível de conhecimento baixo sobre os riscos e complicações da HAS de a população, estrutura dos serviços de saúde inadequados para enfrentar o atendimento de pacientes. Tendo em vista que o controle da Hipertensao Arterial Sistemica demanda ações tanto a nível individual como coletivo e que principalmente deve-se enfatizar no acompanhamento e orientação acertada para que o usuário com hipertensão arterial sistêmica tenha um cuidado continuado adequado, acredita-se que a presente proposta de intervenção possa contribuir para o controle desse e a disminuçao do problema na comunidade assistida
Resumo:
We conducted an open, add-on study with topiramate (TPM) as adjunctive therapy in Lennox-Gastaut syndrome (LGS), to assess the long-term efficacy and safety and to evaluate quality of life (QL) measurements in the chronic use of TPM. We studied 19 patients (11 male; age ranging from 4 to 14 years) with uncontrolled seizures receiving 2-3 anti-epileptic drugs. Patients were followed up to 36 months of treatment. A questionnaire was used to query parents about QL. Seven patients completed the study at 36 months and seizure frequency was reduced > 75% in 4, and < 50% in 3 patients. Two children became seizure free for more than 24 months. Most side effects were CNS related, with the most frequent being somnolence and anorexia. These were generally transient. One patient dropped-out due to powder in the urine. None of the patients required hospitalization. At 36 months, patients' alertness (2/7), interaction with environment (5/7), ability to perform daily activities (5/7), and verbal performance (6/7) improved on TPM. We conclude that TPM may be useful as adjunctive therapy in the treatment of LGS. The efficacy of TPM was maintained in long-term treatment in more than 40% of patients, long term safety was confirmed and QL improved on TPM.
Resumo:
OBJECTIVE: To verify the effectiveness of the support group in the identification of family variables linked to epilepsy. METHOD: Pre-test were applied to parents of 21 children with benign epilepsy of childhood recently diagnosed, from 5 to 15 years, who participated in the groups at HC/Unicamp. There was a presentation of an educational video, discussion and application of the post-test 1. After six months, the post-test 2 was applied. RESULTS: The beliefs were: fear of swallowing the tongue during the seizures (76.19%) and of a future mental disease (66.67%). Facing the epilepsy, fear and sadness appeared. 76.19% of the parents presented overprotection and 90.48%, expected a new seizure. In the post-test 1, the parents affirmed that the information offered had modified the beliefs. In the post-test 2, 80.95% didn't report great doubts about epilepsy and 90.48% considered their relationship with their children better. CONCLUSIONS: The demystification of beliefs supplied from the groups influenced the family positively, prevented behavior alterations and guaranteed effective care in the attendance to the child with epilepsy.
Resumo:
Approximately 7.2% of the Atlantic rainforest remains in Brazil, with only 16% of this forest remaining in the State of Rio de Janeiro, all of it distributed in fragments. This forest fragmentation can produce biotic and abiotic differences between edges and the fragment interior. In this study, we compared the structure and richness of tree communities in three habitats - an anthropogenic edge (AE), a natural edge (NE) and the fragment interior (FI) - of a fragment of Atlantic forest in the State of Rio de Janeiro, Brazil (22°50'S and 42°28'W). One thousand and seventy-six trees with a diameter at breast height > 4.8 cm, belonging to 132 morphospecies and 39 families, were sampled in a total study area of 0.75 ha. NE had the greatest basal area and the trees in this habitat had the greatest diameter:height allometric coefficient, whereas AE had a lower richness and greater variation in the height of the first tree branch. Tree density, diameter, height and the proportion of standing dead trees did not differ among the habitats. There was marked heterogeneity among replicates within each habitat. These results indicate that the forest interior and the fragment edges (natural or anthropogenic) do not differ markedly considering the studied parameters. Other factors, such as the age from the edge, type of matrix and proximity of gaps, may play a more important role in plant community structure than the proximity from edges.
Resumo:
This work approaches the forced air cooling of strawberry by numerical simulation. The mathematical model that was used describes the process of heat transfer, based on the Fourier's law, in spherical coordinates and simplified to describe the one-dimensional process. For the resolution of the equation expressed for the mathematical model, an algorithm was developed based on the explicit scheme of the numerical method of the finite differences and implemented in the scientific computation program MATLAB 6.1. The validation of the mathematical model was made by the comparison between theoretical and experimental data, where strawberries had been cooled with forced air. The results showed to be possible the determination of the convective heat transfer coefficient by fitting the numerical and experimental data. The methodology of the numerical simulations was showed like a promising tool in the support of the decision to use or to develop equipment in the area of cooling process with forced air of spherical fruits.
Resumo:
Knowing the importance that the poultry industry represents for the Brazilian economy, this work, searched to understand and to identify new welfare pointers inherent to the animal that contributed for the increase of the productive effectiveness, studying different behavior reactions in broiler breeders, in climatic chamber. The experiment was delineated as a Latin Square 3x3x3, where the variable: temperature of air, birds ration and birds age had been controlled. The birds of different ages had been lodged in distinct boxes. Observations of the behavior of the birds in two schedules of the day had been made, being one in the morning and the other one in the afternoon, during a period of 15 minutes each through video cameras, installed in the ceiling of the climatic chamber, having no interference of human being in the register of the data. It was verified the influence of the controlled variables in diverse observed behaviors where it was concluded that the presence of food resulted in bigger occurrences of aggressiveness reactions.
Resumo:
In this work the performance of a sugar cane chopped harvester was analysed when fed with two sugar cane mass flows, measuring the invisible losses, which are impossible to measure in the field, harvester sugar cane cleaning efficiency and air velocity on extractors exit. The trial was done under controlled conditions at Copersucar Technology Center in January 2000. The results showed that the flow of sugar cane through the harvester doesn't influence the magnitudes of total invisible losses and raw material cleaning efficiency. The mean air velocity on the primary extractors exit was 12.0 m s-1, and 9.2 m s-1 on the secondary extractor, with a coefficient of variation of 21%, indicating that the poor cleaning performance of the harvester could be related to air velocity difference inside the extractor. Analyzing the data collected in the trials, it was possible to conclude that invisible losses in sugar cane harvester were 10% and the cleaning efficiency was 87%.
Resumo:
No Tillage system is fully incorporated to farming in the region of Campos Gerais, state of Paraná. Accuracy and precision in the planting process are items of great importance for the success of this system. In order to evaluate the planting process, thirty eight farms were selected as sites for analysis of the placement depth of seeds. The research area was 4 or 5 planting rows, evaluating 10 plantlets per row. The average seed depth was around 46 mm, and significant differences between rows were observed in 21 areas. The average coefficient of variation was around 20%, the statistical limit between medium and high. Analyses of other parameters show that those coefficients may represent different errors in the process. The planting process in Campos Gerais can be considered efficient regarding to the average seed depth. However, the analysis of variability implies de need of actions concerning to anthropic and machinery factors.
Resumo:
As a way to reduce water losses in furrow irrigation systems, used in fresh market tomato production, farmers are improperly distributing water into the field using plastic hose. The objective of this work was to study the suitability of using quick coupler sprinkler as hose connectors for water distribution in tomato plantation. The first step of the study was to assess the current hose field operation for tomato growers. Subsequently, four models of quick couplers sprinklers available in the market were tested in laboratory to determine the coefficient of resistance, the equivalent tube length, the head loss curve and the linking efficiency. As result, a structural design for hose connectors was presented using the model of coupling with the best hydraulic performance. Additionally, some technical recommendations on its use in irrigation water distribution are highlighted. Despite the requirement for additional field trials, the proposed system has potential to optimize the water use efficiency, to improve workers ergonomic conditions, and ensure good profitability to the producer.
Resumo:
Size distributions in woody plant populations have been used to assess their regeneration status, assuming that size structures with reverse-J shapes represent stable populations. We present an empirical approach of this issue using five woody species from the Cerrado. Considering count data for all plants of these five species over a 12-year period, we analyzed size distribution by: a) plotting frequency distributions and their adjustment to the negative exponential curve and b) calculating the Gini coefficient. To look for a relationship between size structure and future trends, we considered the size structures from the first census year. We analyzed changes in number over time and performed a simple population viability analysis, which gives the mean population growth rate, its variance and the probability of extinction in a given time period. Frequency distributions and the Gini coefficient were not able to predict future trends in population numbers. We recommend that managers should not use measures of size structure as a basis for management decisions without applying more appropriate demographic studies.
Resumo:
The aim of this study was to determine the effectiveness and reliability of laser fluorescence measurements in relation to occlusal caries diagnosis. DIAGNOdent 2095 (Kavo, Biberach, Germany), which has been developed especially for caries diagnosis, was utilized. Five (5) teeth were examined in the pilot test; after that, ten (10) teeth were examined in order to calibrate both examiners. Data were obtained from 66 teeth (36 molars and 30 premolars), totalizing 144 sites identified through photographs of the occlusal surfaces. Reproducibility was evaluated in 10 teeth. The interexaminer Spearman correlation (r) was 0.89 and the intra-examiner, 0.93 and 0.97 (examiner A and B, respectively). Validation was carried out by histological examination (stereomicroscope). For the two examiners the sensitivity of the device was relatively high, varying from 0.81 to 1.00, while specificity varied according to which validation criterion was used (0.77 - 0.86: enamel lesion / 0.52 - 0.59: dentin lesion). It was concluded that DIAGNodent presented good capacity of identifying any alteration of the dental surface, nevertheless it presents the disadvantage of accomplishing many false-positive diagnosis when the validation criterion is dentin lesion.
Resumo:
The text describes a study about the adoption of virtual learning environments and its consequences to the learning process of undergraduate students at the State University of Campinas - Unicamp. These environments can be incorporated in various ways into the academic daily life of students and teachers. One efficient way to promote the adoption of these environments, as observed by the Distance Learning support team, is to train teachers and students in their use. Two training alternatives are described in this text to instruct the academic community in the use of TelEduc, a freeware developed and coordinated by the NIED - Núcleo de Informática Aplicada à Educação (Center for Information Technology Applied to Education), and officially adopted by Unicamp. Training courses are offered in two ways - presence or distance learning - to suit each teacher's preferences. This article compares the two modes of training, showing their strong and weak points. The adoption of TelEduc and its direct consequences to the learning process are described in a study carried out with some engineering undergraduates at Unicamp. The authors' questions and the general views of teachers and students regarding the effectiveness of the use of TelEduc as a supporting tool to presence teaching are presented. This investigation revealed the importance of training teachers in the effective use of these environments.
Resumo:
This work proposes to determine the water activity and the freezing point depression of tangerine, pineapple and lemon juices at various concentrations (10-55oBrix) and to achieve a correlation between these properties. The freezing point depression was determined with a LAKTRON cryoscope and common laboratory materials. The water activity was determined with a DECAGON CX-2 hygrometer in the temperature range of 15 to 30oC. With the results, the adjustment to CHEN (1987) water activity prediction equation to non-electrolyte mixtures was verified, through the calculation of the variation coefficient (CV). Being CV smaller than 3% for the proposed model, it can be said that the experimental data have adjusted well to the prediction equation. The water activity and the freezing point depression was correlated for tangerine, pineapple and lemon juices and r2 values were higher than 99%. Therefore, it is possible to obtain the water activity by knowing the freezing point depression of studied juices.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.