988 resultados para DOSES


Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of the study was to illustrate the applicability and significance of the novel Lewis urothelial cancer model compared to the classic Fisher 344. Fischer 344 and Lewis females rats, 7 weeks old, were intravesical instilled N-methyl-N-nitrosourea 1.5 mg/kg every other week for a total of four doses. After 15 weeks, animals were sacrificed and bladders analyzed: histopathology (tumor grade and stage), immunohistochemistry (apoptotic and proliferative indices) and blotting (Toll-like receptor 2-TLR2, Uroplakin III-UP III and C-Myc). Control groups received placebo. There were macroscopic neoplastic lesions in 20 % of Lewis strain and 70 % of Fischer 344 strain. Lewis showed hyperplasia in 50 % of animals, normal bladders in 50 %. All Fischer 344 had lesions, 20 % papillary hyperplasia, 30 % dysplasia, 40 % neoplasia and 10 % squamous metaplasia. Proliferative and apoptotic indices were significantly lower in the Lewis strain (p < 0.01). The TLR2 and UP III protein levels were significantly higher in Lewis compared to Fischer 344 strain (70.8 and 46.5 % vs. 49.5 and 16.9 %, respectively). In contrast, C-Myc protein levels were significantly higher in Fischer 344 (22.5 %) compared to Lewis strain (13.7 %). The innovative Lewis carcinogen resistance urothelial model represents a new strategy for translational research. Preservation of TLR2 and UP III defense mechanisms might drive diverse urothelial phenotypes during carcinogenesis in differently susceptible individuals.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Cases of tendinopathy and tendon ruptures have been reported as side effects associated with statin therapy. This work assessed possible changes in the structural and biomechanical properties of the tendons after chronic treatment with statins. Wistar rats were divided into the following groups: treated with atorvastatin (A-20 and A-80), simvastatin (S-20 and S-80) and the group that received no treatment (C). The doses of statins were calculated using allometric scaling, based on the doses of 80 mg/day and 20 mg/day recommended for humans. The morphological aspect of the tendons in A-20, S-20 and S-80 presented signals consistent with degeneration. Both the groups A-80 and S-80 showed a less pronounced metachromasia in the compression region of the tendons. Measurements of birefringence showed that A-20, A-80 and S-80 groups had a lower degree of organization of the collagen fibers. In all of the groups treated with statins, the thickness of the epitenon was thinner when compared to the C group. In the biomechanical tests the tendons of the groups A-20, A-80 and S-20 were less resistant to rupture. Therefore, statins affected the organization of the collagen fibers and decreased the biomechanical strength of the tendons, making them more predisposed to ruptures.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Rubus niveus Thunb. plant belongs to Rosaceae family and have been used traditionally to treat wounds, burns, inflammation, dysentery, diarrhea and for curing excessive bleeding during menstrual cycle. The present study was undertaken to investigate the in vivo genotoxicity of Rubus niveus aerial parts extract and its possible chemoprotection on doxorubicin (DXR)-induced DNA damage. In parallel, the main phytochemicals constituents in the extract were determined. The animals were exposed to the extract for 24 and 48h, and the doses selected were 500, 1000 and 2000mg/kg b.w. administered by gavage alone or prior to DXR (30mg/kg b.w.) administered by intraperitoneal injection. The endpoints analyzed were DNA damage in bone marrow and peripheral blood cells assessed by the alkaline alkaline (pH>13) comet assay and bone marrow micronucleus test. The results of chemical analysis of the extract showed the presence of tormentic acid, stigmasterol, quercitinglucoronide (miquelianin) and niga-ichigoside F1 as main compounds. Both cytogenetic endpoints analyzed showed that there were no statistically significant differences (p>0.05) between the negative control and the treated groups with the two higher doses of Rubus niveus extract alone, demonstrating absence of genotoxic and mutagenic effects. Aneugenic/clastogenic effect was observed only at 2000mg/kg dose. On the other hand, in the both assays and all tested doses were observed a significant reduction of DNA damage and chromosomal aberrations in all groups co-treated with DXR and extract compared to those which received only DXR. These results indicate that Rubus niveus aerial parts extract did not revealed any genotoxic effect, but presented some aneugenic/clastogenic effect at higher dose; and suggest that it could be a potential adjuvant against development of second malignant neoplasms caused by the cancer chemotherapic DXR.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Both high-fat diet and exposure to endocrine-disrupting chemicals have been implicated in susceptibility to pathological prostate lesions, but the consequences of combining the two have not yet been examined. We evaluated the effects of gestational and postnatal exposure to a high-fat diet (20% fat) and low doses of di-n-butyl phthalate (DBP; 5mg/kg/day), individually or in combination, on the tissue response and incidence of pathological lesions in the ventral prostate of adult gerbils. Continuous intake of a high-fat diet caused dyslipidemia, hypertrophy, and promoted the development of inflammatory, premalignant and malignant prostate lesions, even in the absence of obesity. Life-time DBP exposure was obesogenic and dyslipidemic and increased the incidence of premalignant prostate lesions. Combined exposure to DBP and a high-fat diet also caused prostate hypertrophy, but the effects were less severe than those of individual treatments; combined exposure neither induced an inflammatory response nor altered serum lipid content.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The chronic treatment with phenytoin or the acute intoxication by this drug may cause permanent cerebellar injury with atrophy of cerebellum vermis and hemispheres, which can be detected by neuroimaging studies. The aim of the present study was to investigate the correlation between the dosage and duration of treatment with phenytoin and the occurrence of cerebellar atrophy. Sixty-six patients were studied and had their tomographies analyzed for cerebellar atrophy. Of the 66 patients studied, 18 had moderate/severe atrophy, 15 had mild atrophy and 33 were considered to be normal. The patients with moderate/severe atrophy were those with higher exposure to phenytoin (longer duration of treatment and higher total dosage) showing statistically significant difference when compared to patients with mild atrophy or without atrophy (p=0.02). Further, the patients with moderate/severe atrophy had serum levels of phenytoin statistically higher than those of patients with mild atrophy or without atrophy (p = 0.008). There was no association between other antiepileptic drugs dosage or duration of treatment and degree of cerebellar atrophy. We also found that older patients had cerebellar atrophy more frequently, indicating that age or duration of the seizure disorder may also be important in the determination of cerebellar degeneration in these patients. We conclude that although there is a possibility that repeated seizures contribute to cerebellar damage, long term exposure to phenytoin, particularly in high doses and toxic serum levels, cause cerebellar atrophy.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Administration of fractionated doses of irradiation is part of the adjutant therapy for CNS tumours such as craniopharyngiomas and pituitary adenomas. It can maximise cure rates or expand symptom-free period. Among the adverse effects of radiotherapy, the induction of a new tumour within the irradiated field has been frequently described. The precise clinical features that correlate irradiation and oncogenesis are not completely defined, but some authors have suggested that tumors are radiation induced when they are histologically different from the treated ones, arise in greater frequency in irradiated patients than among normal population and tend to occur in younger people with an unusual aggressiveness. In this article, we report a case of a papillary astrocytoma arising in a rather unusual latency period following radiotherapy for craniopharyngioma.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

INTRODUCTION: Like in humans, lower amounts of glycogen are present in tissues of diabetic rats. However, training or drugs that lower glycemia can improve the metabolic control. Metformin increased glycogen while decreased glycemia in normal rats stressed by exercise. OBJECTIVE: In this work we investigated if regular exercise and metformin effects improve the metabolism of diabetic rats. METHODS: Alloxan diabetic Wistar rats treated with metformin (DTM) or not (DT) were trained. Training consisted of 20 sessions of 30 min, 5 days a week. Sedentary diabetic rats served as control (SD and SDM). Metformin (5.6 µg/g) was given in the drinking water. After 48 h resting, glucose (mg/dl) and insulin (ng/mL) was measured in plasma and glycogen (mg/100 mg of wet tissue) in liver, soleus and gastrocnemius. RESULTS: Glycemia decreased in DM group from 435±15 to 230±20, in DT group to 143±8.1 and in DTM group to 138±19 mg/dl. DM group had proportional increase in the hepatic glycogen from 1.69±0.22 to 3.53±0.24, and the training increased to 3.36 ± 0.16 mg/100 mg. Metformin induced the same proportional increase in the muscles (soleus from 0.21±0.008 to 0.42±0.03 and gastrocnemius from 0.33±0.02 to 0.46±0.03), while the training promoted increase on gastrocnemius to 0,53 ± 0,03, only. A high interaction was observed in liver (glycogen increased to 6.48±0.34). CONCLUSION: Very small oral doses of metformin and/or, partially restored glycemia in diabetic rats and decreased glycogen in tissues. Its association with an exercise program was beneficial, helping lower glycemia further and increase glycogen stores on liver of diabetic rats.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Prostaglandins control osteoblastic and osteoclastic function under physiological or pathological conditions and are important modulators of the bone healing process. The non-steroidal anti-inflammatory drugs (NSAIDs) inhibit cyclooxygenase (COX) activity and consequently prostaglandins synthesis. Experimental and clinical evidence has indicated a risk for reparative bone formation related to the use of non-selective (COX-1 and COX-2) and COX-2 selective NSAIDs. Ketorolac is a non-selective NSAID which, at low doses, has a preferential COX-1 inhibitory effect and etoricoxib is a new selective COX-2 inhibitor. Although literature data have suggested that ketorolac can interfere negatively with long bone fracture healing, there seems to be no study associating etoricoxib with reparative bone formation. Paracetamol/acetaminophen, one of the first choices for pain control in clinical dentistry, has been considered a weak anti-inflammatory drug, although supposedly capable of inhibiting COX-2 activity in inflammatory sites. OBJECTIVE: The purpose of the present study was to investigate whether paracetamol, ketorolac and etoricoxib can hinder alveolar bone formation, taking the filling of rat extraction socket with newly formed bone as experimental model. MATERIAL AND METHODS: The degree of new bone formation inside the alveolar socket was estimated two weeks after tooth extraction by a differential point-counting method, using an optical microscopy with a digital camera for image capture and histometry software. Differences between groups were analyzed by ANOVA after confirming a normal distribution of sample data. RESULTS AND CONCLUSIONS: Histometric results confirmed that none of the tested drugs had a detrimental effect in the volume fraction of bone trabeculae formed inside the alveolar socket.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Em razão do crescimento do número de indivíduos submetidos à terapêutica anticoagulante também nos consultórios odontológicos, realizamos um levantamento retrospectivo de prontuários de pacientes anticoagulados com derivados cumarínicos e uma revisão sobre os protocolos de atendimento, a fim de procurar estabelecer diretrizes para um tratamento cirúrgico-odontológico adequado e seguro. A avaliação do paciente com relação ao seu nível de anticoagulação através do Índice Normatizado Internacional (INR) ou Tempo de Protrombina (TP) e a classificação da amplitude do trauma cirúrgico são fatores importantes a serem avaliados antes do procedimento cirúrgico. Nosso levantamento mostrou que, em 47 cirurgias, sem alteração da medicação sistêmica, apenas um caso apresentou hemorragia pós-operatória, controlada por manobras de hemostasia local. Desse modo, observamos que, dentre os vários protocolos propostos na literatura, a manutenção da terapia anticoagulante, com a utilização de hemostáticos locais se necessário, parece o mais adequado à maioria dos casos cirúrgicos ambulatoriais.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Avaliaram-se os efeitos do extrato de maracujá veiculado na dieta (0, 50, 100 e 200mg kg-1) sobre o consumo de alimento, o ganho em peso e os níveis de glicose e cortisol plasmático de juvenis de tilápias do Nilo (87,0±6,6g). Ao final do experimento (28 dias), os peixes foram eutanasiados para remoção do fígado, visando à avaliação da área citoplasmática, contagem de células e verificação dos estoques de glicogênio hepático. Os dados foram submetidos à ANOVA unidirecional, comparando-se as médias pelo Teste de Tukey (P<0,05), com posterior estudo de regressão, buscando estabelecer as curvas das áreas citoplasmáticas, em função das diferentes doses do extrato. A inclusão do extrato na dieta não afetou o consumo de alimento e o crescimento e todos os peixes apresentaram aumento da glicose e redução do cortisol plasmático, porém sem diferenças entre os tratamentos. As curvas de regressão indicaram aumento quadrático da área citoplasmática com a elevação da doses do extrato, principalmente para 100mg kg-1, resultando em uma curva dose-resposta em forma de "U" invertido. O aumento da área do citoplasma decorreu de um acúmulo de glicogênio hepático, conforme comprovado pela prova da amilase salivar. Concluiu-se que o extrato de maracujá pode ser fornecido na dieta de juvenis de tilápia, sem prejudicar o consumo alimentar e o crescimento dos animais e que o produto altera a morfometria dos hepatócitos, sugerindo a atividade de flavonóides sobre o metabolismo de carboidratos.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Application of calcium silicate (SiCa) as soil acidity corrective was evaluated in a Rhodic Hapludox soil with palisade grass conducted under pasture rotation system with different grazing intensities. Experimental design was complete randomized blocks with four grazing intensities - grazing intensities were imposed by forage supply (50, 100, 150 and 200 kg t-1 of DM per LW) - in experimental plots with four replicates and, in the subplots, with seven doses of calcium silicate combined with lime: 0+0, 2+0, 4+0, 6+0, 2+4, 4+2 and 0+6 t ha-1, respectively. In the soil, it was evaluated the effect of four levels of calcium silicate (0, 2, 4 and 6 t ha-1) at 45, 90, and 365 days at three depths (0-10, 10-20 and 20-40 cm) and at 365 days, it was included one level of lime (6 t ha-1). For determination of leaf chemical composition and silicate content in the soil, four levels of calcium silicate (0, 2, 4 and 6 t ha-1) were evaluated at 45 and 365 days and at 45 days only for leaf silicate, whereas for dry matter production, all corrective treatments applied were evaluated in evaluation seasons. Application of calcium silicate was positive for soil chemical traits related to acidity correction (pH(CaCl2), Ca, Mg, K, H+Al and V), but the limestone promoted better results at 365 days. Leaf mineral contents were not influenced by application of calcium silicate, but there was an increase on silicate contents in leaves and in the soil. Dry matter yield and chemical composition of palisade grass improved with the application of correctives.