969 resultados para beta-amilase


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Two botryosphaerans, exopolysaccharides (EPS) secreted by the ascomyceteous fungus Botryosphaeria rhodina, when grown on sucrose and fructose as sole carbon sources, were structurally compared after their isolation from the culture medium. Both EPS were submitted to trypsin digestion, and eluted as a single peak on gel filtration. Total acid hydrolysis yielded only glucose, and data from methylation analysis and Smith degradation indicated that both EPS constituted a main chain of glucopyranosyl beta(1 -> 3) linkages substituted at O-6. The products obtained after partial acid hydrolysis demonstrated side chains consisting of glucosyl- and gentiobiosyl- linked beta(1 -> 6) residues. C-13-NMR spectroscopy studies showed that all glucosidic linkages were of the beta-configuration. The carbon source affected the side chain structures of botryosphaeran but not the main chain makeup. Sucrose produced less branching (21%) than fructose (31%). (c) 2005 Published by Elsevier Ltd.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The exopolysaccharide, Botryosphaeran, produced by the ligninolytic, ascomycetcous fungus Botryosphaeria sp., was isolated from the extracellular fluid by precipitation with ethanol, and purified by gel permeation chromatography to yield a carbohydrate-rich fraction (96%) composed mainly of glucose (98%). Infra-red and C-13 NMR spectroscopy showed that all the glucosidic linkages were in the beta-configuration. Data from methylation analysis and Smith degradation indicated that Botryosphaeran was a (1 --> 3)-beta-(D)-glucan with approx 22% side branching at C-6. The products obtained from partial acid hydrolysis demonstrated that the side branches consisted of single (1 --> 6)-beta-linked glucosyl, and (1 --> 6)-beta-linked gentiobiosyl residues.[GRAPHICS](C) 2003 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Botryosphaeran, a (1 -> 3; 1 -> 6)-beta-D-glucan produced by Botryosphaeria rhodina, and laminarin were hydrolysed by two fungal beta-glucanases predominantly of the 1,3-type produced by B. rhodina and Trichoderma harzianum Rifai grown on botryosphaeran as sole carbon source. Both beta-glucanase preparations presented different modes of attack on botryosphaeran and laminarin. Laminarin was hydrolysed to the extent of similar to 50% in 1 hand 100% within 24 h, and its hydrolysis products were mainly glucose and gentiobiose, and lesser amounts of laminaribiose and oligosaccharides of DP 3-4 during the early stages of hydrolysis, while botryosphaeran 'yielded mainly glucose and gentiobiose with some trisaccharide, but no laminaribiose or tetrasaccharide when hydrolysed by the T. harzianum enzyme. By contrast, B. rhodina beta-1,3-glucanases produced predominantly glucose during all stages of botryosphaeran hydrolysis. Some physicochemical properties of the 1,3- and 1,6-beta-glucanases, and beta-glucosidases contained in the two fungal P-glucanase preparations are also described for the first time. (c) 2006 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Botryosphaeria rhodina and Trichoderma harzianum Rifai were grown on botryosphaeran (an exopolysaccharide (EPS) of the beta-1,3; 1,6-D-Glucan type produced by B. rhodina) as sole carbon source with the objective of producing beta-glucanases of the beta-type. Conditions for beta-1,3-glucanase production by T harzianum were examined by a statistical response surface method, and showed maximal enzyme production at 5 days growth in media containing 1.5 g/1 of EPS. Good agreement was obtained between the experimental values of beta-1, 3-glucanase activity and the corresponding values predicted by the mathernatical model. The crude beta-1,3-glucanase preparations were active towards a number of different beta-1,3-glucans and beta-glucosides. The mycelium of B. rhodina also proved to be a good substrate for beta-1,3-glucanase production by both fungal species. (c) 2005 Published by Elsevier Ltd.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Topical formulations of piroxicam were evaluated by determination of their in vitro release and in vivo anti-inflammatory effect. The in vitro release assay demonstrated that the microemulsion (ME) systems provided a reservoir effect for piroxicam release. However, the incorporation of the ME into carboxyvinilic gel provoked a greater reduction in the release of piroxicam than the ME system alone. Anti-inflammatory activity was carried out by the cotton pellet granuloma inhibition bioassay. Topical anti-inflammatory effect of the piroxicam inclusion complex/ME contained in carboxyvinilic gel showed significant inhibition of the inflammation process (36.9%, P < 0.05). Subcutaneous administration of the drug formulations showed a significant effect on the inhibition of inflammation, 68.8 and 70.5%, P <0.05, when the piroxicam was incorporated in ME and in the combined system beta -cyclodextrin (B-CD)/ME, respectively, relative to the buffered piroxicam (42.2%). These results demonstrated that the ME induced prolonged effects, providing inhibition of the inflammation for 9 days after a single dose administration. (C) 2001 Elsevier B.V. B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The interaction of piroxicam with beta-cyclodextrin (beta-CD), hexadecyltrimethylammonium bromide-based microemulsion (ME), and ME in the presence of beta-CD aimed at the optimization of topical drug delivery was studied. UV-VIS absorption spectra at pH 5.5 were obtained with and without beta-CD and ME. The stability constant (K) values for the piroxicam/beta-CD complex in the pH range 4.5-6.0 varied from 87 to 29 M-1. The cationic microemulsion was characterized by pseudo-ternary phase diagram. The association constant (K-s) of piroxicam/ME was determined using the framework of the pseudophase model. The value of K-s obtained for piroxicam at pH 5.5 was 132 M-1. At the same pH, the value of K-s for the incorporation of piroxicam/beta-CD complex in the ME was 150 M-1. (C) 1999 Elsevier B.V. B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cyclodextrins (CDs) are annular oligosaccharides containing 6-12 glucose unities joined together by alpha-1,4 bonds. They have a conical-truncated shape with a lipophilic cavity in which different molecules can be included resulting in a stable inclusion complex. The cyclodextrins have been widely applied in pharmaceutical technology with the objective of increasing the solubility, stability and bioavailability of drugs in different pharmaceutical dosage forms, such as tablets. In order to obtain beta-CD tablets, liquid dispersions of drug/beta-CD are usually submitted to different drying processes, like spray-drying, freeze-drying or slow evaporation, being this dry material added to a number of excipients. However, such drying processes can generate particulate materials showing problems of flow and compressibility, needing their conversion into granulates by means of wetting with granulation liquid followed by additional drying. In this work, the main objective was to evaluate the preparation of tablets without the need of this additional drying step. For this purpose an aqueous dispersion containing acetaminophen/beta-CD complex and cornstarch was dried using a spouted bed and the obtained granules were compressed in tablets. Acetaminophen was used as model drug due to its low water solubility and the inexpensive and widely available cornstarch was chosen as excipient. Acetaminophen powder was added into a beta-cyclodextrin solution prepared in distilled water at 70 degrees C. Stirring was kept until this dispersion cooled to room temperature. Then cornstarch was added and the resulting dispersion was dried in spouted bed equipment. This material was compressed into tablets using an Erweka Korsh EKO tablet machine. This innovative approach allowed the tablets preparation process to be carried out with fewer steps and represents a technological reliable strategy to produce beta-cyclodextrin inclusion complexes tablets. (C) 2010 Elsevier By. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUÇÃO: As hemoglobinopatias resultam de alterações hereditárias, sendo prevalentes em muitas regiões do mundo, mas atingem a população brasileira de forma significativa. Elas são decorrentes de alterações em genes estruturais responsáveis pelo aparecimento das hemoglobinas variantes e/ou em genes reguladores, resultando nas talassemias. A identificação dessas patologias tem sido rotineiramente realizada por procedimentos eletroforéticos, contudo nossa experiência laboratorial evidencia que as mesmas nem sempre apresentam resoluções suficientes para a correta caracterização da mutação. CASUÍSTICAS E MÉTODOS: O propósito deste trabalho foi estabelecer uma metodologia válida para a caracterização das hemoglobinas S, C e D em homozigose ou heterozigose, e suas possíveis interações, baseada na amplificação gênica alelo-específica (PCR-AE) com a utilização de primers sense, antisense e primers que se acoplam na posição do alelo mutante e na respectiva posição do alelo normal. RESULTADOS E DISCUSSÃO: Os resultados evidenciaram a validade dessa metodologia na caracterização das mutações, sendo esse procedimento de fácil realização, reprodutível e possível de ser aplicado em um significativo número de amostras.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The effect of tetracaine on Ca-45 efflux, cytoplasmic Ca2+ concentration [Ca2+](i), and insulin secretion in isolated pancreatic islets and beta-cells was studied. In the absence of external Ca2+, tetracaine (0.1-2.0 mM) increased the Ca-45 efflux from isolated islets in a dose-dependant manner. Tetracaine did not affect the increase in Ca-45 efflux caused by 50 mM K+ or by the association of carbachol (0.2 mM) and 50 mM K+. Tetracaine permanently increased the [Ca2+](i) in isolated beta-cells in Ca2+-free medium enriched with 2.8 mM glucose and 25 mu M D-600 (methoxiverapamil). This effect was also observed in the presence of 10 mM caffeine or 1 mu M thapsigargin. In the presence of 16.7 mM glucose, tetracaine transiently increased the insulin secretion from islets perfused in the absence and presence of external Ca2+. These data indicate that tetracaine mobilises Ca2+ from a thapsigargin-insensitive store and stimulates insulin secretion in the absence of extracellular Ca2+. The increase in Ca-45 efflux caused by high concentrations of K+ and by carbachol indicates that tetracaine did not interfere with a cation or inositol triphosphate sensitive Ca2+ pool in beta-cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

High protein content in the diet during childhood and adolescence has been associated to the onset insulin-dependent diabetes mellitus. We investigated the effect of interleukin-1 beta (IL-I beta) on insulin secretion, glucose metabolism, and nitrite formation by islets isolated from rats fed with normal protein (NP, 17%) or low protein (LP, 6%) after weaning. Pretreatment of islets with IL-1 beta for 1 h or 34 h inhibited the insulin secretion induced by glucose in both groups, but it was less marked in LP than in NP group. Islets from LP rats exhibited a decreased IL-1 beta -induced nitric oxide (NO) production, lower inhibition of D-[(UC)-C-14]-glucose oxidation to (CO2)-C-14, and less pronounced effect of IL-1 beta on alpha -ketoisocaproic acid-induced insulin secretion than NP islets. However, when the islets were stimulated by high concentrations of K+ the inhibitory effect of IL-1 beta on insulin secretion was not different between groups. In conclusion, protein restriction protects beta -cells of the deleterious effect of IL-1 beta, apparently, by decreasing NO production. The lower NO generation in islets from protein deprived rats may be due to increased free fatty acids oxidation and consequent alteration in Ca2+ homeostasis. (C) 2001 Elsevier B.V. All rights reserved.