959 resultados para Microscope and microscopy
                                
Resumo:
Ameloblastic fibro-odontoma (AFO) is a slow-growing, expansive, benign odontogenic tumor, composed of ameloblastic epithelium embedded in an ectomesenchymal stroma resembling dental papilla, containing hard dental tissue in variable degrees of maturation, including enamel, dentin, and sometimes cementum. AFO typically affects the posterior mandible, causing bony expansion. We report a case of pigmented AFO in a 5-year-old boy, comprising clinical and histological features illustrated by immunohistochemistry using a large panel of antibodies, polarized light microscopy and scanning electron microscopy.
                                
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Correlation between margin fit and microleakage in complete crowns cemented with three luting agents
                                
Resumo:
Microleakage can be related to margin misfit. Also, traditional microleakage techniques are time-consuming. This study evaluated the existence of correlation between in vitro margin fit and a new microleakage technique for complete crowns cemented with 3 different luting agents. Thirty human premolars were prepared for full-coverage crowns with a convergence angle of 6 degrees, chamfer margin of 1.2 mm circumferentially, and occlusal reduction of 1.5 mm. Ni-Cr cast crowns were cemented with either zinc phosphate (ZP) (S.S. White), resin-modified glass-ionomer (RMGI) (Rely X Luting Cement) or a resin-based luting agent (RC) (Enforce). Margin fit (seating discrepancy and margin gap) was evaluated according to criteria in the literature under microscope with 0.001 mm accuracy. After thermal cycling, crowns were longitudinally sectioned and microleakage scores at tooth-cement interface were obtained and recorded at ×100 magnification. Margin fit parameters were compared with the one-way ANOVA test and microleakage scores with Kruskal-Wallis and Dunn's tests (alpha=0.05). Correlation between margin fit and microleakage was analyzed with the Spearman's test (alpha=0.05). Seating discrepancy and marginal gap values ranged from 81.82 µm to 137.22 µm (p=0.117), and from 75.42 µm to 78.49 µm (p=0.940), respectively. Marginal microleakage scores were ZP=3.02, RMGI=0.35 and RC=0.12 (p<0.001), with no differences between RMGI and RC scores. The correlation coefficient values ranged from -0.27 to 0.30 (p>0.05). Conclusion: Margin fit parameters and microleakage showed no strong correlations; cast crowns cemented with RMGI and RC had lower microleakage scores than ZP cement.
                                
Resumo:
Dental roots that have been exposed to the oral cavity and periodontal pocket environment present superficial changes, which can prevent connective tissue reattachment. Demineralizing agents have been used as an adjunct to the periodontal treatment aiming at restoring the biocompatibility of roots. OBJECTIVE: This study compared four commonly used demineralizing agents for their capacity of removing smear layer and opening dentin tubules. METHODS: Fifty fragments of human dental roots previously exposed to periodontal disease were scaled and randomly divided into the following groups of treatment: 1) CA: demineralization with citric acid for 3 min; 2) TC-HCl: demineralization with tetracycline-HCl for 3 min; 3) EDTA: demineralization with EDTA for 3 min; 4) PA: demineralization with 37% phosphoric acid for 3 min; 5) Control: rubbing of saline solution for 3 min. Scanning electron microscopy was used to check for the presence of residual smear layer and for measuring the number and area of exposed dentin tubules. RESULTS: Smear layer was present in 100% of the specimens from the groups PA and control; in 80% from EDTA group; in 33.3% from TC-HCl group and 0% from CA group. The mean numbers of exposed dentin tubules in a standardized area were: TC-HCl=43.8±25.2; CA=39.3±37; PA=12.1±16.3; EDTA=4.4±7.5 and Control=2.3±5.7. The comparison showed significant differences between the following pairs of groups: TC-HCl and Control; TC-HCl and EDTA; CA and Control; and CA and EDTA. The mean percentages of area occupied by exposed dentin tubules were: CA=0.12±0.17%; TC-HCl=0.08±0.06%; PA=0.03±0.05%; EDTA=0.01±0.01% and Control=0±0%. The CA group differed significantly from the others except for the TC-HCl group. CONCLUSION: There was a decreasing ability for smear layer removal and dentin tubule widening as follows: AC>TC-HCl>PA>EDTA. This information can be of value as an extra parameter for choosing one of them for root conditioning.
                                
Resumo:
Removable partial dentures (RPD) demand specific hygienic cleaning and the combination of brushing with immersion in chemical solutions has been the most recommended method for control of biofilm. However, the effect of the cleansers on metallic components has not been widely investigated. This study evaluated the effect of different cleansers on the surface of RPD. Five disc specimens (12 mm x 3 mm metallic disc centered in a 38 x 18 x 4 mm mould filled with resin) were obtained for each experimental situation: 6 solutions [Periogard (PE), Cepacol (CE), Corega Tabs (CT), Medical Interporous (MI), Polident (PO), 0.05% sodium hypochlorite (NaOCl), and distilled water (DW) control] and 2 Co-Cr alloys [DeguDent (DD) and VeraPDI (VPDI)] were used for each experimental situation. A 180-day immersion was simulated and the measurements of roughness (Ra, µm) of metal and resin were analyzed using 2-way ANOVA and Tukey’s test. The surface changes and tarnishes were examined with a scanning electronic microscopy (SEM). In addition, energy dispersive x-ray spectrometry (EDS) analysis was carried out at representative areas. Visually, NaOCl and MI specimens presented surface tarnishes. The roughness of materials was not affected by the solutions (p>0.05). SEM images showed that NaOCl and MI provided surface changes. EDS analysis revealed the presence of oxygen for specimens in contact with both MI and NaOCl solutions, which might suggest that the two solutions promoted the oxidation of the surfaces, thus leading to spot corrosion. Within the limitations of this study, it may be concluded that the NaOCl and MI may not be suitable for cleaning of RPD.
                                
Resumo:
This study investigated whether there is a direct correlation between the level of vertical misfit at the abutment/implant interface and torque losses (detorque) in abutment screws. A work model was obtained from a metal matrix with five 3.75 x 9 mm external hex implants with standard platform (4.1 mm). Four frameworks were waxed using UCLA type abutments and one-piece cast in commercially pure titanium. The misfit was analyzed with a comparator microscope after 20 Ncm torque. The highest value of misfit observed per abutment was used. The torque required to loose the screw was evaluated using a digital torque meter. The torque loss values, measured by the torque meter, were assumed as percentage of initial torque (100%) given to abutment screws. Pearson's correlation (α=0.05) between the misfit values (29.08 ± 8.78 µm) and the percentage of detorque (50.71 ± 11.37%) showed no statistically significant correlation (p=0.295). Within the limitations of this study, it may be concluded that great vertical misfits dot not necessarily implies in higher detorque values.
                                
Resumo:
This study evaluated the influence of a cola-type soft drink and a soy-based orange juice on the surface and subsurface erosion of primary enamel, as a function of the exposure time. Seventy-five primary incisors were divided for microhardness test (n=45) or scanning electron microscopy (SEM) analysis (n=30). The specimens were randomly assigned to 3 groups: 1 - artificial saliva (control); 2 - cola-type soft drink; and 3 - soy-based orange juice. Immersion cycles in the beverages were undertaken under agitation for 5 min, 3 times a day, during 60 days. Surface microhardness was measured at 7, 15, 30, 45 and 60 days. After 60 days, specimens were bisected and subsurface microhardness was measured at 30, 60, 90, 120, 150 and 200 µm from the surface exposed. Data were analyzed by ANOVA and Tukey’s test (a=0.05). Groups 2 and 3 presented similar decrease of surface microhardness. Regarding subsurface microhardness, group 2 presented the lowest values. SEM images revealed that after 60 days the surfaces clearly exhibited structural loss, unlike those immersed in artificial saliva. It may be concluded that erosion of the surfaces exposed to the cola-type soft drink was more accentuated and directly proportional to the exposure time.
                                
Resumo:
This study evaluated in vitro the shear bond strength (SBS) of a resin-based pit-and-fissure sealant [Fluroshield (F), Dentsply/Caulk] associated with either an etch-and-rinse [Adper Single Bond 2 (SB), 3M/ESPE] or a self-etching adhesive system [Clearfil S3 Bond (S3), Kuraray Co., Ltd.] to saliva-contaminated enamel, comparing two curing protocols: individual light curing of the adhesive system and the sealant or simultaneous curing of both materials. Mesial and distal enamel surfaces from 45 sound third molars were randomly assigned to 6 groups (n=15), according to the bonding technique: I - F was applied to 37% phosphoric acid etched enamel. The other groups were contaminated with fresh human saliva (0.01 mL; 10 s) after acid etching: II - SB and F were light cured separately; III - SB and F were light cured together; IV - S3 and F were light cured separately; V - S3 and F were light cured simultaneously; VI - F was applied to saliva-contaminated, acid-etched enamel without an intermediate bonding agent layer. SBS was tested to failure in a universal testing machine at 0.5 mm/min. Data were analyzed by one-way ANOVA and Fisher's test (α=0.05).The debonded specimens were examined with a stereomicroscope to assess the failure modes. Three representative specimens from each group were observed under scanning electron microscopy for a qualitative analysis. Mean SBS in MPa were: I-12.28 (±4.29); II-8.57 (±3.19); III-7.97 (±2.16); IV-12.56 (±3.11); V-11.45 (±3.77); and VI-7.47 (±1.99). In conclusion, individual or simultaneous curing of the intermediate bonding agent layer and the resin sealant did not seem to affect bond strength to saliva-contaminated enamel. S3/F presented significantly higher SBS than the that of the groups treated with SB etch-and-rinse adhesive system and similar SBS to that of the control group, in which the sealant was applied under ideal dry, noncontaminated conditions.
                                
Resumo:
The use of an adequate method for evaluation of the adhesion of root canal filling materials provides more reliable results to allow comparison of the materials and substantiate their clinical choice. The aims of this study were to compare the shear bond strength (SBS) test and push-out test for evaluation of the adhesion of an epoxy-based endodontic sealer (AH Plus) to dentin and gutta-percha, and to assess the failure modes on the debonded surfaces by means of scanning electron microscopy (SEM). Three groups were established (n=7): in group 1, root cylinders obtained from human canines were embedded in acrylic resin and had their canals prepared and filled with sealer; in group 2, longitudinal sections of dentin cylinders were embedded in resin with the canal surface smoothed and turned upwards; in group 3, gutta-percha cylinders were embedded in resin. Polyethylene tubes filled with sealer were positioned on the polished surface of the specimens (groups 2 and 3). The push-out test (group 1) and the SBS test (groups 2 and 3) were performed in an Instron universal testing machine running at crosshead speed of 1 mm/min. Means (±SD) in MPa were: G1 (8.8±1.13), G2 (5.9±1.05) and G3 (3.8±0.55). Statistical analysis by ANOVA and Student's t-test (a=0.05) revealed statistically significant differences (p<0.01) among the groups. SEM analysis showed a predominance of adhesive and mixed failures of AH Plus sealer. The tested surface affected significantly the results with the sealer reaching higher bond strength to dentin than to gutta-percha with the SBS test. The comparison of the employed methodologies showed that the SBS test produced significantly lower bond strength values than the push-out test, was skilful in determining the adhesion of AH Plus sealer to dentin and gutta-percha, and required specimens that could be easily prepared for SEM, presenting as a viable alternative for further experiments.
                                
Resumo:
OBJECTIVE: The aim of this study was to evaluate the morphology of glass (GF), carbon (CF) and glass/carbon (G/CF) fiber posts and their bond strength to self or dual-cured resin luting agents. MATERIAL AND METHODS: Morphological analysis of each post type was conducted under scanning electron microscopy (SEM). Bond strength was evaluated by microtensile test after bisecting the posts and re-bonding the two halves with the luting agents. Data were subjected to two-way ANOVA and Tukey's test (α=0.05). Failure modes were evaluated under optical microscopy and SEM. RESULTS: GF presented wider fibers and higher amount of matrix than CF, and G/CF presented carbon fibers surrounded by glass fibers, and both involved by matrix. For CF and GF, the dual-cured material presented significantly higher (p<0.05) bond strength than the self-cured agent. For the dual agent, CF presented similar bond strength to GF (p>0.05), but higher than that of G/CF (p<0.05). For the self-cured agent, no significant differences (p>0.05) were detected, irrespective of the post type. For GF and G/CF, all failures were considered mixed, while a predominance of adhesive failures was detected for CF. CONCLUSION: The bonding between fiber posts and luting agents was affected by the type of fibers and polymerization mode of the cement. When no surface treatment of the post is performed, the bonding between glass fiber post and dual-cured agent seems to be more reliable.
                                
Resumo:
This study investigated the influence of cervical preflaring with different rotary instruments on determination of the initial apical file (IAF) in mesiobuccal roots of mandibular molars. Fifty human mandibular molars whose mesial roots presented two clearly separated apical foramens (mesiobuccal and mesiolingual) were used. After standard access opening and removal of pulp tissue, the working length (WL) was determined at 1 mm short of the root apex. Five groups (n=10) were formed at random, according to the type of instrument used for cervical preflaring. In group 1, the size of the IAF was determined without preflaring of the cervical and middle root canal thirds. In groups 2 to 5, preflaring was performed with Gates-Glidden drills, ProTaper instruments, EndoFlare instruments and LA Axxes burs, respectively. Canals were sized manually with K-files, starting with size 08 K-files, inserted passively up to the WL. File sizes were increased until a binding sensation was felt at the WL and the size of the file was recorded. The instrument corresponding to the IAF was fixed into the canal at the WL with methylcyanoacrylate. The teeth were then sectioned transversally 1 mm short of the apex, with the IAF in position. Cross-sections of the WL region were examined under scanning electron microscopy and the discrepancies between canal diameter and the diameter of IAF were calculated using the tool "rule" (FEG) of the microscope's proprietary software. The measurements (µm) were analyzed statistically by Kruskal-Wallis and Dunn's tests at 5% significance level. There were statistically significant differences among the groups (p<0.05). The non-flared group had the greatest discrepancy (125.30 ± 51.54) and differed significantly from all flared groups (p<0.05). Cervical preflaring with LA Axxess burs produced the least discrepancies (55.10 ± 48.31), followed by EndoFlare instruments (68.20 ± 42.44), Gattes Glidden drills (68.90 ± 42.46) and ProTaper files (77.40 ± 73.19). However, no significant differences (p>0.05) were found among the rotary instruments. In conclusion, cervical preflaring improved IAF fitting to the canals at the WL in mesiobuccal roots of maxillary first molars. The rotary instruments evaluated in this study did not differ from each other regarding the discrepancies produced between the IAF size and canal diameter at the WL.
                                
Resumo:
The aim of this study was to assess qualitatively, by means of SEM images, the cleaning of the dentin walls of root canals after chemical-surgical preparation using Endo-PTC cream with 0.5% and 1% sodium hypochlorite and different final irrigating solutions. Seventy-two single-rooted human teeth were divided into eight groups and prepared using Endo-PTC cream with sodium hypochlorite (NaOCl) at different concentrations, and irrigated with NaOCl at different concentrations. Final irrigation was performed with either EDTA-T or EDTA-C. The best results were obtained with Group 1, followed by Groups 5, 2, 7, 8, 3, 6 and 4. We can conclude that the use of 0.5% NaOCl during instrumentation and final flush of the root canals was more efficient in cleaning than was 1% sodium hypochlorite. EDTA-T was more efficient in removing smear layer than EDTA-C, and the cervical third presented better cleaning of the root canal walls than did the middle third, which showed cleaner dentin walls than the apical third.
                                
Resumo:
This study compared the mandibular displacement from three methods of centric relation record using an anterior jig associated with (A) chin point guidance, (B) swallowing (control group) and (C) bimanual manipulation. Ten patients aged 25-39 years were selected if they met the following inclusion criteria: complete dentition (up to the second molars), Angle class I and absence of signs and symptoms of temporomandibular disorders and diagnostic casts showing stability in the maximum intercuspation (MI) position. Impressions of maxillary and mandibular arches were made with an irreversible hydrocolloid impression material. Master casts of each patient were obtained, mounted on a microscope table in MI as a reference position and 5 records of each method were made per patient. The mandibular casts were then repositioned with records interposed and new measurements were obtained. The difference between the two readings allowed measuring the displacement of the mandible in the anteroposterior and lateral axes. Data were analyzed statistically by ANOVA and Tukey's test at 5% significance level. There was no statistically significant differences (p>0.05) among the three methods for measuring lateral displacement (A=0.38 ± 0.26, B=0.32 ± 0.25 and C=0.32 ± 0.23). For the anteroposterior displacement (A=2.76 ± 1.43, B=2.46 ± 1.48 and C=2.97 ± 1.51), the swallowing method (B) differed significantly from the others (p<0.05), but no significant difference (p>0.05) was found between chin point guidance (A) and bimanual manipulation (C). In conclusion, the swallowing method produced smaller mandibular posterior displacement than the other methods.
                                
Resumo:
The purpose of this study was to test the hypothesis that both human and bovine sclerotic dentin have similar hardness properties, in addition to similar micromorphological characteristics. Sixteen teeth (8 human and 8 bovine) exhibiting exposed dentin in the incisal edge and showing characteristics typical of sclerosis were used. Vickers surface microhardness testing was conducted. Three areas of the dentin surface of each specimen were selected. All teeth were processed for scanning electron microscopy in order to estimate the amount (in percentage) of solid dentin on the sclerotic dentin surface. The data were compared by Student's t test (α = 0.05). The micromorphological and microhardness data were compared by Pearson's linear correlation test (α = 0.05). The mean percentages of solid dentin of human and bovine sclerotic dentin were similar (human 90.71 ± 0.83 and bovine 89.08 ± 0.81, p = 0.18). The mean microhardness value (VHN) of human sclerotic dentin was significantly higher than that of bovine sclerotic dentin (human 45.26 ± 2.92 and bovine 29.93 ± 3.83, p = 0.006). No correlation was found between the microhardness values and the amount of solid dentin in the sclerotic dentin, irrespective of the species considered (human R² = 0.0240, p = 0.714; bovine R² = 0.0017, p = 0.923; and combined R² = 0.038, p = 0.46). We concluded that although both bovine and human sclerotic dentin present a similar amount of solid tissue, human sclerotic dentin presents higher microhardness than bovine sclerotic dentin.
                                
Resumo:
With the increase in life expectancy, biomaterials have become an increasingly important focus of research because they are used to replace parts and functions of the human body, thus contributing to improved quality of life. In the development of new biomaterials, the Ti-15Mo alloy is particularly significant. In this study, the Ti-15Mo alloy was produced using an arc-melting furnace and then characterized by density, X-ray diffraction, optical microscopy, hardness and dynamic elasticity modulus measurements, and cytotoxicity tests. The microstructure was obtained with β predominance. Microhardness, elasticity modulus, and cytotoxicity testing results showed that this material has great potential for use as biomaterial, mainly in orthopedic applications.
 
                    