955 resultados para Duality in Gauge Field Theories
Resumo:
This paper traces the history of the study of pragmatics in Brazil. It is shown that Brazilian researches have, by and large, remained attentive to major developments in the field taking place elsewhere in the world. Of particular importance is the burgeoning tendency to focus attention on social issues affecting the day-to-day lives of ordinary people. More and more researchers are realizing the need to assume a critical role in relation to the theories they encounter in the literature.
Resumo:
The copolymer poly (L-co-D,L lactic acid), PLDLA, has gained prominence in the field of temporary prostheses due to the fact that their time of degradation is quite compatible with the requirement in the case of osseous fracture. In this work the in vivo degradation of devices from copolymer, as a system of plates and screws, used in fixation of the tibia of rabbits was studied. The devices were implanted in 15 adult rabbits, albinos, New Zealand race, and they were used as control devices of alloys of titanium (Ti-6Al-4V/ V grade). The use of copolymers, synthesized in the laboratory, was tested in the repair of fracture in rabbits'tibias, being assessed in the following times: 2 weeks, 2 months and 3 months. Morphological analysis of tissue surrounding the plate and screw system, for 2 weeks of implantation, showed the presence of osteoblasts, indicating a pre bone formation. After 2 months there was new bone formation in the region in contact with the polymer. This bone growth occurred simultaneously with the process of PLDLA degradation, invading the region where there was polymer and after 3 months there was an intense degradation of the copolymer and hence greater tissue invasion compared to 2 months which characterized bone formation in a region where the polymer degraded. The in vivo degradation study of the devices for PLDLA by means of histological evaluations during the period of consolidation of the fracture showed the efficiency of plate and screw system, and it was possible to check formation of bone tissue at the implantation site, without the presence of inflammatory reaction
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
The influence of the golden lion tamarin (Leontopithecus rosalia) as a seed disperser was studied by monitoring two groups of tamarins from December 1998 to December 2000 (871.9 hours of observations) in a forest fragment in south-east Brazil. The tamarins consumed fruits of 57 species from at least 17 families. They ingested the seeds of 39 species, and 23 of these were put to germinate in the laboratory and/or in the field. L. rosalia is a legitimate seed disperser because the seeds of all species tested germinated after ingestion, albeit some in low percentages. These primates do not show a consistent effect in final seed germination, because they benefit some species while damaging others. Feces were examined for seeds that had been preyed upon or digested.
Resumo:
The objective of this study was to review the Brazilian epidemiologic literature on periodontal outcomes and socio-demographic factors, assessing bibliographic and methodological characteristics of this scientific production, as well as the consistency and statistical significance of the examined associations. A systematic review was carried out in six bibliographic sources. The review was limited to the period between 1999 and 2008, without any other type of restriction. Among the 410 papers identified, 29 were included in the review. An increasing number of articles, specifically in the last four years of study, was observed. However, there is a concentration of studies in the South and Southeast regions of Brazil, and many of them are not closely connected to theoretical formulations in the field. In spite of these shortcomings, the review findings corroborate the idea that poor socioeconomic conditions are associated with periodontal outcomes, as demonstrated primarily by income and schooling indicators.
Resumo:
Este trabalho apresenta, a partir de histórias de vida, características do processo de "encontro transformador" entre dois moradores de rua e uma professora, que foi "ponto de apoio" positivo em suas vidas. O "encontro transformador" é interação entre os seres humanos que possibilita a transformação dos envolvidos, no sentido de despertar suas potencialidades, a retomada do sentido da vida, promovendo-lhes a resiliência, que é a capacidade humana de fazer frente às adversidades da vida, superá-las e sair delas fortalecidos e, inclusive, transformados. O estudo longitudinal realizado envolveu o resgate de histórias de vida, através de entrevistas abertas, fotografias, registros em Diário de Campo e desenhos feitos pelos sujeitos de observação. Na interpretação dos dados contemplou-se o emprego de conceitos de determinadas teorias de: Psicologia, Geografia, Sociologia, Direito, Ciências da Educação, Complexidade e Sistêmica, em diálogo entre diferentes disciplinas. A análise do fenômeno - em que o morar na rua surgiu como situação existencial excludente - revelou nova configuração nas psiques dos moradores de rua, em movimento de transformação. No fenômeno observado - complexo - desvelou-se a dificuldade dos moradores de rua estudados de se manterem no processo resiliente sem o apoio efetivo da Sociedade Civil e do Estado, a partir de políticas públicas voltadas para esse tipo de população. Conclui-se pela importância dos resultados deste trabalho como contribuição para a ampliação de processos de formação, não só de profissionais que atuam com moradores de rua como de integrantes da sociedade em geral, norteados por uma visão solidária de busca de cidadania para todos.
Resumo:
Este trabalho apresenta, a partir de histórias de vida, características do processo de "encontro transformador" entre dois moradores de rua e uma professora, que foi "ponto de apoio" positivo em suas vidas. O "encontro transformador" é interação entre os seres humanos que possibilita a transformação dos envolvidos, no sentido de despertar suas potencialidades, a retomada do sentido da vida, promovendo-lhes a resiliência, que é a capacidade humana de fazer frente às adversidades da vida, superá-las e sair delas fortalecidos e, inclusive, transformados. O estudo longitudinal realizado envolveu o resgate de histórias de vida, através de entrevistas abertas, fotografias, registros em Diário de Campo e desenhos feitos pelos sujeitos de observação. Na interpretação dos dados contemplou-se o emprego de conceitos de determinadas teorias de: Psicologia, Geografia, Sociologia, Direito, Ciências da Educação, Complexidade e Sistêmica, em diálogo entre diferentes disciplinas. A análise do fenômeno - em que o morar na rua surgiu como situação existencial excludente - revelou nova configuração nas psiques dos moradores de rua, em movimento de transformação. No fenômeno observado - complexo - desvelou-se a dificuldade dos moradores de rua estudados de se manterem no processo resiliente sem o apoio efetivo da Sociedade Civil e do Estado, a partir de políticas públicas voltadas para esse tipo de população. Conclui-se pela importância dos resultados deste trabalho como contribuição para a ampliação de processos de formação, não só de profissionais que atuam com moradores de rua como de integrantes da sociedade em geral, norteados por uma visão solidária de busca de cidadania para todos
Resumo:
Non-alcoholic fatty liver disease (NAFLD) encompasses the whole spectrum of steatosis, nonalcoholic steatohepatitis (NASH), and NASH-related cirrhosis (NASH/Cir). Although molecular advances have been made in this field, the pathogenesis of NAFLD is not completely understood. The gene expression profiling associated to NASH/Cir was assessed, in an attempt to better characterize the pathways involved in its etiopathogenesis. Methods: In the first step, we used cDNA microarray to evaluate the gene expression profiles in normal liver (n=3) and NASH/Cir samples (n=3) by GeneSifter (TM) analysis to identify differentially expressed genes and biological pathways. Second, tissue microarray was used to determine immunohistochemical expression of phosphorylated mTOR and 4E-BP1 in 11 normal liver samples, 10 NASH/Cir samples and in 37 samples of cirrhosis of other etiologies to further explore the involvement of the mTOR pathway evidenced by the gene expression analysis. Results: 138 and 106 genes were, respectively, up and down regulated in NASH/Cir in comparison to normal liver. Among the 9 pathways identified as significantly modulated in NASH/Cir, the participation of the mTOR pathway was confirmed, since expression of cytoplasmic and membrane phospho-mTOR were higher in NASH/Cir in comparison to cirrhosis of other etiologies and to normal liver. Conclusions: Recent findings have suggested a role for the cellular ""nutrient sensor"" mTOR in NAFLD and the present study corroborates the participation of this pathway in NASH/Cir. Phospho-mTOR evaluation might be of clinical utility as a potential marker for identification of NASH/Cir in cases mistakenly considered as cryptogenic cirrhosis owing to paucity of clinical data.
Resumo:
The relationship between prolactin (PRL) and the immune system has been demonstrated in the last two decades and has opened new windows in the field of immunoendocrinology. However, there are scarce reports about PRL in primary antiphospholipid syndrome (pAPS). The objective of this study was to evaluate PRL levels in patients with pAPS compared to healthy controls and to investigate their possible clinical associations. Fifty-five pAPS patients according to Sapporo criteria were age- and sex-matched with 41 healthy subjects. Individuals with secondary causes of hyperprolactinemia (HPRL) were excluded; demographic, biometric, and clinical data, PRL levels, antiphospholipid antibodies, inflammatory markers, and other routine laboratory findings were analyzed. PRL levels were similar between pAPS and healthy controls (8.94 +/- 7.02 versus 8.71 +/- 6.73 ng/mL, P = .876). Nine percent of the pAPS patients and 12.1% of the control subjects presented HPRL (P = .740). Comparison between the pAPS patients with hyper- and normoprolactinemia revealed no significant differences related to anthropometrics, clinical manifestations, medications, smoking, and antiphospholipid antibodies (P > .05). This study showed that HPRL does not seem to play a role in clinical manifestations of the pAPS, differently from other autoimmune rheumatic diseases.
Resumo:
Background: Despite significant advances in neurosurgical techniques, the median survival time of patients with glioblastoma has improved little over the past 50 years and remains less than one year. Photodynamic therapy (PDT) is presently established as a widely accepted modality for the treatment of a variety of solid tumors. Objectives: This study evaluated the effect of PDT-Photogem (R) on five glioma cell lines (U87, U138, U251, U343, and T98G). Methods: The experiments were carried out in 25-cm(3) flasks with different groups of cells seeded at a density of 1 x 10(5) cells per flask. After 3 h, the medium was removed, and the cells were incubated for 4 h with Photogem (5 mu g/mL). After the incubation time, the photosensitizer-containing medium was removed and the cells were irradiated with LED (630 nm, 25 mW/cm(2), 25 J/cm(2)) devices for 17 min. For the final steps of the PDT, the cells were returned to the incubator and kept at 37 degrees C with 5% CO(2) for 24 h, the cell viability assay was assessed using the trypan blue method, and the expression of Caspase 3 mRNA levels was assessed by real-time quantitative PCR. Results: Upon PDT-Photogem (R) treatment, viable cells, as evaluated by the trypan blue dye-exclusion method, decreased in two cell lines (U87 and U138) but not in the other three. Apoptosis, as assessed by the expression of caspase-3 mRNA levels, was at least partly involved in the death mechanism of the cell lines. Conclusions: Collectively, our results indicated that PDT-Photogem (R) can act in glioma cells, thus encouraging new experiments in this field.
Resumo:
Background: In areas with limited structure in place for microscopy diagnosis, rapid diagnostic tests (RDT) have been demonstrated to be effective. Method: The cost-effectiveness of the Optimal (R) and thick smear microscopy was estimated and compared. Data were collected on remote areas of 12 municipalities in the Brazilian Amazon. Data sources included the National Malaria Control Programme of the Ministry of Health, the National Healthcare System reimbursement table, hospitalization records, primary data collected from the municipalities, and scientific literature. The perspective was that of the Brazilian public health system, the analytical horizon was from the start of fever until the diagnostic results provided to patient and the temporal reference was that of year 2006. The results were expressed in costs per adequately diagnosed cases in 2006 U. S. dollars. Sensitivity analysis was performed considering key model parameters. Results: In the case base scenario, considering 92% and 95% sensitivity for thick smear microscopy to Plasmodium falciparum and Plasmodium vivax, respectively, and 100% specificity for both species, thick smear microscopy is more costly and more effective, with an incremental cost estimated at US$ 549.9 per adequately diagnosed case. In sensitivity analysis, when sensitivity and specificity of microscopy for P. vivax were 0.90 and 0.98, respectively, and when its sensitivity for P. falciparum was 0.83, the RDT was more cost-effective than microscopy. Conclusion: Microscopy is more cost-effective than OptiMal (R) in these remote areas if high accuracy of microscopy is maintained in the field. Decision regarding use of rapid tests for diagnosis of malaria in these areas depends on current microscopy accuracy in the field.
Resumo:
Aims. We determine the iron distribution function (IDF) for bulge field stars, in three different fields along the Galactic minor axis and at latitudes b = -4 degrees, b = -6 degrees, and b = -12 degrees. A fourth field including NGC 6553 is also included in the discussion. Methods. About 800 bulge field K giants were observed with the GIRAFFE spectrograph of FLAMES@VLT at spectral resolution R similar to 20 000. Several of them were observed again with UVES at R similar to 45 000 to insure the accuracy of the measurements. The LTE abundance analysis yielded stellar parameters and iron abundances that allowed us to construct an IDF for the bulge that, for the first time, is based on high-resolution spectroscopy for each individual star. Results. The IDF derived here is centered on solar metallicity, and extends from [Fe/H] similar to -1.5 to [Fe/H] similar to + 0.5. The distribution is asymmetric, with a sharper cutoff on the high-metallicity side, and it is narrower than previously measured. A variation in the mean metallicity along the bulge minor axis is clearly between b = -4 degrees and b = -6 degrees ([Fe/H] decreasing similar to by 0.6 dex per kpc). The field at b = -12 degrees. is consistent with the presence of a gradient, but its quantification is complicated by the higher disk/bulge fraction in this field. Conclusions. Our findings support a scenario in which both infall and outflow were important during the bulge formation, and then suggest the presence of a radial gradient, which poses some challenges to the scenario in which the bulge would result solely from the vertical heating of the bar.
Resumo:
Context. The turbulent pumping effect corresponds to the transport of magnetic flux due to the presence of density and turbulence gradients in convectively unstable layers. In the induction equation it appears as an advective term and for this reason it is expected to be important in the solar and stellar dynamo processes. Aims. We explore the effects of turbulent pumping in a flux-dominated Babcock-Leighton solar dynamo model with a solar-like rotation law. Methods. As a first step, only vertical pumping has been considered through the inclusion of a radial diamagnetic term in the induction equation. In the second step, a latitudinal pumping term was included and then, a near-surface shear was included. Results. The results reveal the importance of the pumping mechanism in solving current limitations in mean field dynamo modeling, such as the storage of the magnetic flux and the latitudinal distribution of the sunspots. If a meridional flow is assumed to be present only in the upper part of the convective zone, it is the full turbulent pumping that regulates both the period of the solar cycle and the latitudinal distribution of the sunspot activity. In models that consider shear near the surface, a second shell of toroidal field is generated above r = 0.95 R(circle dot) at all latitudes. If the full pumping is also included, the polar toroidal fields are efficiently advected inwards, and the toroidal magnetic activity survives only at the observed latitudes near the equator. With regard to the parity of the magnetic field, only models that combine turbulent pumping with near-surface shear always converge to the dipolar parity. Conclusions. This result suggests that, under the Babcock-Leighton approach, the equartorward motion of the observed magnetic activity is governed by the latitudinal pumping of the toroidal magnetic field rather than by a large scale coherent meridional flow. Our results support the idea that the parity problem is related to the quadrupolar imprint of the meridional flow on the poloidal component of the magnetic field and the turbulent pumping positively contributes to wash out this imprint.
Resumo:
Aims. We present lithium abundance determination for a sample of K giant stars in the Galactic bulge. The stars presented here are the only 13 stars with a detectable lithium line (6767.18 angstrom) among similar to 400 stars for which we have spectra in this wavelength range, half of them in Baade's Window (b = -4 degrees) and half in a field at b = -6 degrees. Methods. The stars were observed with the GIRAFFE spectrograph of FLAMES mounted on VLT, with a spectral resolution of R similar to 20 000. Abundances were derived from spectral synthesis and the results are compared with those of stars with similar parameters, but no detectable Li line. Results. We find 13 stars with a detectable Li line, among which 2 have abundances A(Li) > 2.7. No clear correlations were found between the Li abundance and those of other elements. With the exception of the two most Li rich stars, the others follow a fairly tight A(Li) - T(eff) correlation. Conclusions. There is strong indication of a Li production phase during the red giant branch (RGB), acting either on a very short timescale, or selectively only in some stars. That the proposed Li production phase is associated with the RGB bump cannot be excluded, although our targets are significantly brighter than the predicted RGB bump magnitude for a population at 8 kpc.