Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Isolation of Pseudomonas aeruginosa strains from dental office environments and units in Barretos, state of São Paulo, Brazil, and analysis of their susceptibility to antimicrobial drugs

A wide variety of opportunistic pathogens has been detected in the tubing supplying water to odontological equipment, in special in the biofilm lining of these tubes. Among these pathogens, Pseudomonas aeruginosa, one of the leading causes of nosocomial infections, is frequently found in water lines supplying dental units. In the present work, 160 samples of water, and 200 fomite samples from forty dental units were collected in the city of Barretos, State of São Paulo, Brazil and evaluated between January and July, 2005. Seventy-six P. aeruginosa strains, isolated from the dental environment (5 strains) and water system (71 strains), were tested for susceptibility to six antimicrobial drugs most frequently used against P. aeruginosa infections. Susceptibility to ciprofloxacin, followed by meropenem was the predominant profile. The need for effective means of reducing the microbial burden within dental unit water lines is emphasized, and the risk of exposure and cross-infection in dental practice, in special when caused by opportunistic pathogens like P. aeruginosa, are highlighted.

Systemic treatment in severe cases of recurrent aphthous stomatitis: an open trial

PURPOSE: This study aimed to evaluate the efficacy of the systemic drugs thalidomide, dapsone, colchicine, and pentoxifylline in the treatment of severe manifestations of RAS. METHODS: An open, 4-year clinical trial was carried out for 21 consecutive patients with severe RAS. Initially, patients were given a 2-week course of prednisone to bring them to a baseline status. Simultaneously, one of the four test drugs was assigned to each patient to be taken for a period of 6 months. During the course of the trial, patients were switched to one of the other three drugs whenever side effects or a lack of satisfactory results occurred, and the 6-month limit of the treatment was then reset. RESULTS: The most efficient and best-tolerated drug was thalidomide, which was administered to a total of eight patients and resulted in complete remission in seven (87.5%). Dapsone was prescribed for a total of nine patients, of whom eight (89%) showed improvement in their symptoms, while five showed complete remission. Colchicine was administered to a total of ten patients, with benefits observed in nine (90%), of whom four showed complete remission. Pentoxyfilline was administered to a total of five patients, with benefits observed in three (60%), of whom one patient showed complete remission. CONCLUSION: The therapeutic methods used in this trial provided significant symptom relief. Patients experienced relapses of the lesions; however, this occurred after withdrawal of their medication during the follow-up period.

Thermal performance of sisal fiber-cement roofing tiles for rural constructions

Roofing provides the main protection against direct solar radiation in animal housing. Appropriate thermal properties of roofing materials tend to improve the thermal comfort in the inner ambient. Nonasbestos fiber-cement roofing components reinforced with cellulose pulp from sisal (Agave sisalana) were produced by slurry and dewatering techniques, with an optional addition of polypropylene fibers. Nonasbestos tiles were evaluated and compared with commercially available asbestos-cement sheets and ceramic tiles (frequently chosen as roofing materials for animal housing). Thermal conductivity and thermal diffusivity of tiles were determined by the parallel hot-wire method, along with the evaluation of the downside surface temperature. Cement-based components reinforced with sisal pulp presented better thermal performance at room temperature (25ºC), while those reinforced with sisal pulp added by polypropylene fibers presented better thermal performance at 60ºC. Non-asbestos cement tiles provided more efficient protection against radiation than asbestos corrugated sheets.

Influência de diferentes materiais de cobertura no conforto térmico de instalações para frangos de corte no oeste paulista

Este trabalho apresenta um estudo da influência de diferentes materiais de cobertura no conforto térmico de instalações destinadas à criação de frangos de corte. A pesquisa foi desenvolvida no Câmpus Experimental da UNESP de Dracena - SP. Quatro protótipos em escala real foram construídos, com área de 28 m² cada, cobertos com telha reciclada à base de embalagens longa vida, telha cerâmica, telha cerâmica pintada de branco e telha de fibrocimento. Os dados foram coletados durante o período de inverno de 2007, totalizando 90 dias. Com esses dados, foram calculados os índices de conforto térmico Carga Térmica Radiante (CTR) e a variável ambiental (Ta). Uma análise estatística por inferência e descritiva foi realizada com os valores do índice de conforto térmico e da variável ambiental. Com os resultados obtidos, é possível afirmar que a telha reciclada apresentou índices de conforto térmico semelhantes àqueles encontrados para as telhas cerâmicas. O protótipo coberto com telha de fibrocimento apresentou os maiores índices, e o coberto com telha cerâmica branca, os menores índices de conforto térmico. No entanto para o período de inverno e para os horários avaliados, todas as instalações apresentaram índices de conforto térmico fora da zona de termoneutralidade do frango de corte.

Reserve carbohydrates and lipids from the seeds of four tropical tree species with different sensitivity to desiccation

Considering the importance of water content for the conservation and storage of seeds, and the involvement of soluble carbohydrates and lipids for embryo development, a comparative study was carried out among the seeds of Inga vera (ingá), Eugenia uniflora (pitanga), both classified as recalcitrant, and Caesalpinia echinata (brazilwood) and Erythrina speciosa (mulungu), considered as orthodox seeds. Low concentrations of cyclitols (0.3-0.5%), raffinose family oligosaccharides (ca. 0.05%) and unsaturated fatty acids (0-19%) were found in the seeds of ingá and pitanga, while larger amounts of cyclitols (2-3%) and raffinose (4.6-13%) were found in brazilwood and mulungu, respectively. These results, in addition to higher proportions of unsaturated fatty acids (53-71%) in orthodox seeds, suggested that sugars and lipids played important role in water movement, protecting the embryo cell membranes against injuries during dehydration.

Aves da Estação Ecológica de Itirapina, estado de São Paulo, Brasil

O cerrado é um dos biomas mais ameaçados no mundo, apresentando algumas das maiores taxas de destruição causadas principalmente pela agropecuária. Poucos estudos têm avaliado a diversidade local de aves no cerrado, especialmente em áreas marginais desse bioma. A Estação Ecológica de Itirapina (EEI) contém um dos últimos remanescentes de campos naturais e cerrados do estado de São Paulo. Um levantamento das aves desta unidade de conservação, feito tanto por observações casuais como sistemáticas entre 1998 e 2007, e complementado por revisão de literatura, revelou que 231 espécies apresentaram ocorrência recente na área. Desse total, 38 espécies (16,4%) encontram-se na lista de espécies ameaçadas para o estado de São Paulo e/ou são endêmicas do Cerrado, um alto número quando comparado com outras áreas de cerrados paulistas ou mesmo em relação ao Brasil Central. Tal fato reforça a importância da EEI em relação à conservação da avifauna e demonstra que a mesma está mantendo sua função de conservar a biodiversidade. Adicionalmente, ao longo dos 10 anos de estudo foram detectadas várias ameaças à EEI, e neste sentido são recomendadas aqui algumas sugestões de manejo que consideramos essenciais para essa unidade de conservação manter ou mesmo aumentar sua diversidade de aves.

Monitorização materno-fetal durante procedimento odontológico em portadora de cardiopatia valvar

FUNDAMENTO: Os efeitos da anestesia local em odontologia com lidocaína e epinefrina, sobre parâmetros cardiovasculares de gestantes portadoras de valvopatias e seus conceptos, não estão esclarecidos. OBJETIVO: Avaliar e analisar parâmetros da cardiotocografia, de pressão arterial e eletrocardiográficos da gestante portadora de doença valvar reumática, quando submetida à anestesia local com 1,8 ml de lidocaína 2% sem vasoconstritor e com epinefrina 1:100.000, durante procedimento odontológico restaurador. MÉTODOS: Realizamos monitorização ambulatorial da pressão arterial, eletrocardiografia ambulatorial materna e cardiotocografia de 31 portadoras de cardiopatia reumática, entre a 28ª e 37ª semana de gestação, divididas em dois grupos conforme presença ou não do vasoconstritor RESULTADOS: Demonstrou-se redução significativa dos valores de frequência cardíaca materna nos dois grupos, durante o procedimento, quando comparado aos demais períodos (p < 0,001). Houve ocorrência de arritmia cardíaca em 9 (29,0%) pacientes, das quais 7 (41,8%) pertencentes ao grupo de 17 gestantes que recebeu anestesia com adrenalina. A pressão arterial materna não apresentou diferença quando comparamos períodos ou grupos (p > 0,05). O mesmo ocorreu (p > 0,05) com número de contrações uterinas, nível e variabilidade da linha de base e número de acelerações da frequência cardíaca fetal. CONCLUSÃO: O uso de 1,8 ml de lidocaína 2% associado à adrenalina mostrou-se seguro e eficaz em procedimento odontológico restaurador durante a gestação de mulheres com cardiopatia valvar reumática.

Doença granulomatosa crônica: diagnóstico no primeiro episódio infeccioso

OBJETIVO: Relatar caso ilustrativo de doença granulomatosa crônica cujo diagnóstico ocorreu durante o aparecimento do primeiro episódio infeccioso, colaborando com a iniciativa do Brazilian Group for Immunodeficiency para a sensibilização do pediatra geral em relação ao diagnóstico precoce das imunodeficiências primárias, o que está associado a melhor qualidade de vida e maior sobrevida desses indivíduos. DESCRIÇÃO DE CASO: Paciente do sexo masculino, 39 dias de vida, admitido em pronto-socorro pediátrico por febre alta há cinco dias e irritabilidade. No dia seguinte, observou-se abscesso cervical, isolando-se Staphylococcus aureus comunitário. Durante a internação, ocorreram outros abscessos superficiais e em cadeias ganglionares profundas, além de resposta lenta aos antimicrobianos. Solicitou-se investigação para imunodeficiências, que confirmou a hipótese de doença granulomatosa crônica por quantificação dos ânions superóxido e teste de redução do nitrobluetetrazolio. Paciente foi encaminhado a serviço especializado, no qual identificou-se doador de medula óssea compatível, realizando-se o transplante seis meses após o diagnóstico. Quatro meses após o transplante, ocorreu normalização do burst oxidativo, indicando sucesso. COMENTÁRIOS: O paciente mostrou apresentação típica da doença, o que permitiu seu diagnóstico por pediatras gerais já na primeira infecção, tendo como consequência o acompanhamento por especialistas em imunodeficiências primárias, a introdução da profilaxia antimicrobiana e a procura bem sucedida de doador de medula HLA-compatível.

Lessons from the Terra Preta de Índios of the Amazon region for the utilisation of charcoal for soil amendment

The potential of charcoal and of partially combusted organic waste to mimic the soil organic matter of the Terras Pretas de Índios (Amazonian Dark Earths) from the Amazon Region is discussed. These materials serve as soil conditioners and as sequesterers of carbon in recalcitrant and in reactive forms. Studies carried out by Brazilian and by international groups have contributed to the emergence of an awareness of the compositions and of the uses of these materials. In this contribution we report on chemical studies that are leading to the development of a scientific and technological awareness, and of innovations that will have value in finding novel uses in applications to soil of chars from organic wastes such as those from the biofuel industry, and from metallurgical and various coal plant residues.

O carste no plano de manejo do Parque Estadual Intervales e zona de amortecimento, Estado de São Paulo, Brasil

O Parque Estadual Intervales (PEI) e sua Zona de Amortecimento (ZA), inseridos nos vales dos rios Ribeira de Iguape e Paranapanema, situam-se em domínios de rochas carbonáticas proterozóicas de grande interesse para a mineração, onde se verifica a formação de carste com ocorrência expressiva de cavernas. A caracterização do carste no PEI e ZA para o plano de manejo foi baseada em estudos geológicos e geomorfológicos que permitiram definir o grau de vulnerabilidade à contaminação do aquífero cárstico. As regiões de maior vulnerabilidade do carste no PEI e ZA são aquelas que permitem a introdução direta de contaminantes no aquífero e se caracterizam pela presença de feições cársticas tais como cavernas e sumidouros. Para as regiões onde a recarga ocorre exclusivamente por infiltração difusa e o escoamento superficial converge para rios de superfície, foi associado grau de vulnerabilidade intermediário. Considerando essa análise, foram identificadas áreas com maior potencial para impactos e feitas recomendações para a gestão do parque e sua zona de amortecimento.

Identificação química da clorofenilpiperazina (CPP) em comprimidos apreendidos

Designer drug is a term used to describe psychoactive drugs of abuse which are usually synthesized by modifying the molecular structures of existing drugs of abuse. The term gained widespread popularity when MDMA (ecstasy) experienced a popularity boom in the mid 1980´s. In Brazil, designer drugs seizures have increased in the last few years, and actually tablets with unknown psychoactive compounds began to be forwarded to the Forensic Laboratories. This work describes the analytical assays that were performed to identify the chlorophenylpiperazine, a psychoactive substance first time identified in seized tablets in Sao Paulo state.

Eletroforese capilar acoplada à espectrometria de massas (CE-MS): vinte anos de desenvolvimento

CE-MS has been increasingly used for analysis of a vast array of compounds. This article reviews the different electrophoretic modes, interfaces and mass analyzers that are commonly used in the CE-MS coupling, as well as the technique advantages and performance characteristics. A large compilation of CE-MS applications is also presented. Therefore, this review is both a guide for beginners and a collection of key references for people who are familiar to the technique. Furthermore, this is the first CE-MS review published in a Brazilian journal and marks the installation of the first two commercial CE-MS units in Sao Paulo State.

Estudo da decomposição térmica de propelente sólido compósito de baixa emissão de fumaça

The thermal decomposition of hydroxyl-terminated polybutadiene (HTPB)/ammonium nitrate (AN) based propellants, so called smokeless formulations, and raw materials were investigated by differential scanning calorimetry (DSC) and thermogravimetry (TG). The thermoanalytical profile of different components and of propellant were evaluated and the Arrhenius parameters for the thermal decomposition of the propellant sample were determined by the Ozawa method. The kinetic parameters of the thermal decomposition of propellant samples were determined by DSC measurements. The values obtained for activation energy (Ea) and pre-exponential factor were 163 kJ mol-1 and 1.94x10(6) min-1.