The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Radiotherapy Does Not Impair Dentin Adhesive Properties In Head And Neck Cancer Patients.

This study evaluated the influence of radiotherapy on the dentin bond strength of teeth extracted from patients who had undergone head and neck radiotherapy. A total of 36 samples were divided into two experimental groups: group I (control group, n = 18) and group II (in vivo irradiated group, n = 18). Groups I and II were further separated into three subgroups (six specimens per subgroup), which were further assigned to the three adhesive system protocols employed: Single Bond 2 (SB) (3M ESPE), Easy Bond (EB) (3M ESPE) and Clearfil SE Bond (CSE) (Kuraray). The adhesive systems were applied to the prepared surface according to the manufacturers' instructions and restored using composite resin (Filtek Supreme, 3M ESPE). After 24 h in deionised water (37(o)C), teeth were horizontally and vertically cut to obtain beam specimens with a cross-section area of 0.8 ± 1.0 mm(2). Specimens were tested in tension using a universal testing machine at a cross-speed of 0.5 mm/min. Fracture patterns were observed under SEM. Data was analysed by two-way analysis of variance (p ≤ 0.05). No statistically significant difference was found between the irradiated (R/SB = 44.66 ± 10.12 MPa; R/EB = 41.48 ± 12.71 MPa; and R/CSE = 46.01 ± 6.98 MPa) and control group (C/SB = 39.12 ± 9.51 MPa; C/EB = 42.40 ± 6.66 MPa; and C/CSE = 36.58 ± 7.06 MPa) for any of the adhesive systems. All groups presented a predominance of mixed fracture modes. Head and neck radiotherapy did not affect dentin bond strength for the adhesive materials tested in this study.

Tshr Intronic Polymorphisms (rs179247 And Rs12885526) And Their Role In The Susceptibility Of The Brazilian Population To Graves' Disease And Graves' Ophthalmopathy.

Intronic thyroid-stimulating hormone receptor polymorphisms have been associated with the risk for both Graves' disease and Graves' ophthalmopathy, but results have been inconsistent among different populations. We aimed to investigate the influence of thyroid-stimulating hormone receptor intronic polymorphisms in a large well-characterized population of GD patients. We studied 279 Graves' disease patients (231 females and 48 males, 39.80 ± 11.69 years old), including 144 with Graves' ophthalmopathy, matched to 296 healthy control individuals. Thyroid-stimulating hormone receptor genotypes of rs179247 and rs12885526 were determined by Real Time PCR TaqMan(®) SNP Genotyping. A multivariate analysis showed that the inheritance of the thyroid-stimulating hormone receptor AA genotype for rs179247 increased the risk for Graves' disease (OR = 2.821; 95 % CI 1.595-4.990; p = 0.0004), whereas the thyroid-stimulating hormone receptor GG genotype for rs12885526 increased the risk for Graves' ophthalmopathy (OR = 2.940; 95 % CI 1.320-6.548; p = 0.0083). Individuals with Graves' ophthalmopathy also presented lower mean thyrotropin receptor antibodies levels (96.3 ± 143.9 U/L) than individuals without Graves' ophthalmopathy (98.3 ± 201.9 U/L). We did not find any association between the investigated polymorphisms and patients clinical features or outcome. We demonstrate that thyroid-stimulating hormone receptor intronic polymorphisms are associated with the susceptibility to Graves' disease and Graves' ophthalmopathy in the Brazilian population, but do not appear to influence the disease course.

Polymorphisms Of Cell Cycle Control Genes Influence The Development Of Sporadic Medullary Thyroid Carcinoma.

The role of key cell cycle regulation genes such as, CDKN1B, CDKN2A, CDKN2B, and CDKN2C in sporadic medullary thyroid carcinoma (s-MTC) is still largely unknown. In order to evaluate the influence of inherited polymorphisms of these genes on the pathogenesis of s-MTC, we used TaqMan SNP genotyping to examine 45 s-MTC patients carefully matched with 98 controls. A multivariate logistic regression analysis demonstrated that CDKN1B and CDKN2A genes were related to s-MTC susceptibility. The rs2066827*GT+GG CDKN1B genotype was more frequent in s-MTC patients (62.22%) than in controls (40.21%), increasing the susceptibility to s-MTC (OR=2.47; 95% CI=1.048-5.833; P=0.038). By contrast, the rs11515*CG+GG of CDKN2A gene was more frequent in the controls (32.65%) than in patients (15.56%), reducing the risk for s-MTC (OR=0.174; 95% CI=0.048-0.627; P=0.0075). A stepwise regression analysis indicated that two genotypes together could explain 11% of the total s-MTC risk. In addition, a relationship was found between disease progression and the presence of alterations in the CDKN1A (rs1801270), CDKN2C (rs12885), and CDKN2B (rs1063192) genes. WT rs1801270 CDKN1A patients presented extrathyroidal tumor extension more frequently (92%) than polymorphic CDKN1A rs1801270 patients (50%; P=0.0376). Patients with the WT CDKN2C gene (rs12885) presented larger tumors (2.9±1.8 cm) than polymorphic patients (1.5±0.7 cm; P=0.0324). On the other hand, patients with the polymorphic CDKN2B gene (rs1063192) presented distant metastases (36.3%; P=0.0261). In summary, we demonstrated that CDKN1B and CDKN2A genes are associated with susceptibility, whereas the inherited genetic profile of CDKN1A, CDKN2B, and CDKN2C is associated with aggressive features of tumors. This study suggests that profiling cell cycle genes may help define the risk and characterize s-MTC aggressiveness.

Use Of Experimental Design To Optimize A Triple-potential Waveform To Develop A Method For The Determination Of Streptomycin And Dihydrostreptomycin In Pharmaceutical Veterinary Dosage Forms By Hplc-pad.

An HPLC-PAD method using a gold working electrode and a triple-potential waveform was developed for the simultaneous determination of streptomycin and dihydrostreptomycin in veterinary drugs. Glucose was used as the internal standard, and the triple-potential waveform was optimized using a factorial and a central composite design. The optimum potentials were as follows: amperometric detection, E1=-0.15V; cleaning potential, E2=+0.85V; and reactivation of the electrode surface, E3=-0.65V. For the separation of the aminoglycosides and the internal standard of glucose, a CarboPac™ PA1 anion exchange column was used together with a mobile phase consisting of a 0.070 mol L(-1) sodium hydroxide solution in the isocratic elution mode with a flow rate of 0.8 mL min(-1). The method was validated and applied to the determination of streptomycin and dihydrostreptomycin in veterinary formulations (injection, suspension and ointment) without any previous sample pretreatment, except for the ointments, for which a liquid-liquid extraction was required before HPLC-PAD analysis. The method showed adequate selectivity, with an accuracy of 98-107% and a precision of less than 3.9%.

Preference Mapping Of Dulce De Leche Commercialized In Brazilian Markets.

Dulce de leche samples available in the Brazilian market were submitted to sensory profiling by quantitative descriptive analysis and acceptance test, as well sensory evaluation using the just-about-right scale and purchase intent. External preference mapping and the ideal sensory characteristics of dulce de leche were determined. The results were also evaluated by principal component analysis, hierarchical cluster analysis, partial least squares regression, artificial neural networks, and logistic regression. Overall, significant product acceptance was related to intermediate scores of the sensory attributes in the descriptive test, and this trend was observed even after consumer segmentation. The results obtained by sensometric techniques showed that optimizing an ideal dulce de leche from the sensory standpoint is a multidimensional process, with necessary adjustments on the appearance, aroma, taste, and texture attributes of the product for better consumer acceptance and purchase. The optimum dulce de leche was characterized by high scores for the attributes sweet taste, caramel taste, brightness, color, and caramel aroma in accordance with the preference mapping findings. In industrial terms, this means changing the parameters used in the thermal treatment and quantitative changes in the ingredients used in formulations.

Chromobacterium Amazonense Sp. Nov. Isolated From Water Samples From The Rio Negro, Amazon, Brazil.

The taxonomic position of a bacterium isolated from water samples from the Rio Negro, in Amazon, Brazil, was determined by using a polyphasic approach. The organism formed a distinct phyletic line in the Chromobacterium 16S rRNA gene tree and had chemotaxonomic and morphological properties consistent with its classification in this genus. It was found to be closely related to Chromobacterium vaccinii DSM 25150(T) (98.6 % 16S rRNA gene similarity) and shared 98.5 % 16S rRNA gene similarity with Chromobacterium piscinae LGM 3947(T). DNA-DNA relatedness studies showed that isolate CBMAI 310(T) belongs to distinct genomic species. The isolate was readily distinguished from the type strain of these species using a combination of phenotypic and chemotaxonomic properties. Thus, based on genotypic and phenotypic data, it is proposed that isolate CBMAI 310(T) (=DSM 26508(T)) be classified in the genus Chromobacterium as the type strain of a novel species, namely, Chromobacterium amazonense sp. nov.

Polymorphism In Lep And Lepr May Modify Leptin Levels And Represent Risk Factors For Thyroid Cancer.

Purpose. To understand the role of polymorphisms in the LEP (rs7799039 and rs2167270) and LEPR (rs1137101 and rs1137100) genes in DTC susceptibility and their effect on leptin levels. Methods. We studied 153 patients with DTC and 234 controls through TaqMan SNP Genotyping and ELISA, comparing these data to the clinicopathological data of patients with DTC. Results. Patients with AA genotype of rs7799039 had higher levels of serum leptin (9.22 ± 0.98 ng/mL) than those with AG genotype (10.07 ± 0.60 ng/mL; P = 0.005). Individuals with AG genotype of rs2167270 also produced higher serum leptin levels (10.05 ± 0.59 ng/mL) than the subjects with GG genotype (9.52 ± 0.79 ng/mL; P < 0.05). A multivariate logistic regression adjusted for gender, age, and BMI showed that the AG genotype of rs7799039 was an independent risk for DTC (OR, 11.689; P = 0.0183; 95% CI, 1.516-90.119). Similarly, AG and GG genotypes of rs1137101 increased the susceptibility to DTC (OR, 3.747; P = 0.027; 95% CI, 1.161-12.092 and OR, 5.437; P = 0.013; 95% CI, 1.426-20.729). Conclusions. We demonstrated that rs7799039 and rs2167270 polymorphisms modify the serum leptin concentrations in patients with DTC. Furthermore, polymorphisms rs7799039 and rs1137101 increase the risk of DTC development, although they do not correlate with tumor aggressiveness.

Aplicação do escore MELD em pacientes submetidos a transplante de fígado: análise retrospectiva da sobrevida e dos fatores preditivos a curto e longo prazo

BACKGROUND: The model for end-stage liver disease (MELD) was developed to predict short-term mortality in patients with cirrhosis. There are few reports studying the correlation between MELD and long-term posttransplantation survival. AIM: To assess the value of pretransplant MELD in the prediction of posttransplant survival. METHODS: The adult patients (age >18 years) who underwent liver transplantation were examined in a retrospective longitudinal cohort of patients, through the prospective data base. We excluded acute liver failure, retransplantation and reduced or split-livers. The liver donors were evaluated according to: age, sex, weight, creatinine, bilirubin, sodium, aspartate aminotransferase, personal antecedents, brain death cause, steatosis, expanded criteria donor number and index donor risk. The recipients' data were: sex, age, weight, chronic hepatic disease, Child-Turcotte-Pugh points, pretransplant and initial MELD score, pretransplant creatinine clearance, sodium, cold and warm ischemia times, hospital length of stay, blood requirements, and alanine aminotransferase (ALT >1,000 UI/L = liver dysfunction). The Kaplan-Meier method with the log-rank test was used for the univariable analyses of posttransplant patient survival. For the multivariable analyses the Cox proportional hazard regression method with the stepwise procedure was used with stratifying sodium and MELD as variables. ROC curve was used to define area under the curve for MELD and Child-Turcotte-Pugh. RESULTS: A total of 232 patients with 10 years follow up were available. The MELD cutoff was 20 and Child-Turcotte-Pugh cutoff was 11.5. For MELD score > 20, the risk factors for death were: red cell requirements, liver dysfunction and donor's sodium. For the patients with hyponatremia the risk factors were: negative delta-MELD score, red cell requirements, liver dysfunction and donor's sodium. The regression univariated analyses came up with the following risk factors for death: score MELD > 25, blood requirements, recipient creatinine clearance pretransplant and age donor >50. After stepwise analyses, only red cell requirement was predictive. Patients with MELD score < 25 had a 68.86%, 50,44% and 41,50% chance for 1, 5 and 10-year survival and > 25 were 39.13%, 29.81% and 22.36% respectively. Patients without hyponatremia were 65.16%, 50.28% and 41,98% and with hyponatremia 44.44%, 34.28% and 28.57% respectively. Patients with IDR > 1.7 showed 53.7%, 27.71% and 13.85% and index donor risk <1.7 was 63.62%, 51.4% and 44.08%, respectively. Age donor > 50 years showed 38.4%, 26.21% and 13.1% and age donor <50 years showed 65.58%, 26.21% and 13.1%. Association with delta-MELD score did not show any significant difference. Expanded criteria donors were associated with primary non-function and severe liver dysfunction. Predictive factors for death were blood requirements, hyponatremia, liver dysfunction and donor's sodium. CONCLUSION: In conclusion MELD over 25, recipient's hyponatremia, blood requirements, donor's sodium were associated with poor survival.

Diretrizes curriculares nacionais para o ensino médio: avaliação de documento

This text offers some contributions to the debate on the changes proposed to the National Curricular Directives to reform secondary education in Brazil. In the first part, the political and economic scene is evaluated as the context which generated the last stage of reforms in the educational field in the 90s. It questions the option for a model of structural reform (in the Brazilian case more restricted to the Program for Reform of Professional Education - PROEP) and of the curriculum, whose themes find their justification in the contemporary economic, social cultural and political context. It discusses the use of a model that bases itself on experiences developed in other countries and takes the international orientation of the multilateral organizations as its theoretical methodological reference, leaving out the peculiarities and injunctions of the Brazilian political administrative system. Such a policy measure can increase the tension and distance normally existing between government programs and the possibility of their real implementation in the school network. In the second part, it discusses the Resolution of the National Education Council, the Congress on Basic Education, no.3, of 16.698 that instituted the National Curricular Directives for secondary education, as well as the Legal Bases - Part I - of the National Curricular Parameters for secondary education. The analysis of official discourse takes Bardin's (1977, p. 209) proposals as its methodological reference for the models of structural analysis, seeking to make the implicit values and the connotations of the legal texts explicit

Metodologia analítica para determinação de folatos e ácido fólico em alimentos

The aim of this work was to develop and to validate a methodology using HPLC for the simultaneous determination of folates and folic acid in foods. The limits of detection and the recovery rates for the vitamins in the certified reference materials were respectively 5 pg/mL and 94-108% for 5-MTHF, 7 pg/mL and 97-102% for THF, 30 pg/mL and 97.9-104% for 5-FTHF, 30 pg/mL and 95-107 for 10-FFA, 5 ng/mL and 97-102% for FA and 5 ng/mL and 98-103% for 10-MFA. Repeatability showed a coefficient of variation below 3.9% for all the vitamins. The proposed methodology was shown to be efficient when applied to different certified reference materials, namely pig's liver (BCR487), powdered milk (BCR421) and a vegetable mixture (BCR485).

Otimização do descascamento químico de raízes do yacon (Polymnia sonchifolia Poepp.)

A full factorial design 2³ was used to evaluate the effect of process variables in chemical peeling of yacon roots, cultivated in Curitiba, State of Paraná. Eleven treatments, with three central points, were done in which they had been evaluated at three different levels of sodium hydroxide solution, % (g/100 mL) [6, 10, 14], temperature of the same solution, °C [70, 80, 90], and residence time in the sodium hydroxide solution, minutes [2, 4, 6]. All the studied variables had affected significantly (p<0.05) the yield of yacon roots subjected to chemical peeling. The variable that most affected the yield was the time of permanence in the sodium hydroxide solution. The mathematical model obtained for the yield (%) was good with R² aj = 0.8497, and non significant lack of fit (p=0.9312).Therefore, the model can be used for predictive purposes. In the central point a satisfactory yield (84% to 87%) with a high percentage of removed peel was obtained (96% to 98%) indicating that the treatment with 10% of sodium hydroxide solution, temperature of 80º C per 4 minutes can be used in the chemical peeling of yacon roots.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Curva de aprendizado e flutuações a curto e longo prazos com perimetria de freqüência dupla (FDT)

OBJECTIVE: To evaluate the learning effect, short-term fluctuation and long-term fluctuation in healthy subjects undergoing frequency doubling perimetry (FDP). METHODS: Twenty healthy young subjects underwent FDT (program N30, full threshold) in one eye (right). Each subject was tested once in the first three sessions and three times in the fourth session. Both short- and long-term fluctuations were studied as the average fluctuation of all the tested points or as a point-to-point fluctuation. To study the learning effect, the MDs values of the first session were compared to the second, third and fourth sessions. RESULTS: In the short-term analysis (3 examination done in the last session), the total mean sensitivity was 31.91 ± 1.20 dB and the mean MD and PSD were 0.84 ± 1.85 and 3.73 ± 1.55 dB, respectively. The average short-term fluctuation was 1.72 ± 0.38 dB. When the four examination, performed at different visits, were compared, the average mean sensitivity of all sessions and the average long-term fluctuation were 31.75 ± 1.11 and 2.16 ± 0.26 dB, respectively. The MD averages of the first, second, third and fourth tests were 0.11 ± 2.14 dB, 0.47 ± 1.64 dB, 1.16 ± 1.62 dB and 0.98 ± 1.92 dB respectively. The MD difference between the first and the third and between the first and the fourth examinations were statistically significant (p<0.05). CONCLUSION: The threshold sensitivity detected by FDP is influenced by both short- and long-term fluctuations. We observed a mild learning effect that shoud be taken into account whenever a patient undergoes this test for the first time.

Influence of English language in the number of citations of articles published in Brazilian journals of Ophthalmology

PURPOSE: To determine the association between language and number of citations of ophthalmology articles published in Brazilian journals. METHODS: This study was a systematic review. Original articles were identified by review of documents published at the two Brazilian ophthalmology journals indexed at Science Citation Index Expanded - SCIE [Arquivos Brasileiros de Oftalmologia (ABO) and Revista Brasileira de Oftalmologia (RBO)]. All document types (articles and reviews) listed at SCIE in English (English Group) or in Portuguese (Portuguese Group) from January 1, 2008 to December 31, 2009 were included, except: editorial materials; corrections; letters; and biographical items. The primary outcome was the number of citations through the end of second year after publication date. Subgroup analysis included likelihood of citation (cited at least once versus no citation), journal, and year of publication. RESULTS: The search at the web of science revealed 382 articles [107 (28%) in the English Group and 275 (72%) in the Portuguese Group]. Of those, 297 (77.7%) were published at the ABO and 85 (23.3%) at the RBO. The citation counts were statistically significantly higher (P<0.001) in the English Group (1.51 - SD 1.98 - range 0 to 11) compared with the Portuguese Group (0.57 - SD 1.06 - range 0 to 7). The likelihood citation was statistically significant higher (P<0.001) in the English Group (70/107 - 65.4%) compared with the Portuguese Group (89/275 - 32.7%). There were more articles published in English at the ABO (98/297 - 32.9%) than at the RBO (9/85 - 10.6%) [P<0.001]. There were no significant difference (P=0.967) at the proportion of articles published in English at the years 2008 (48/172 - 27.9%) and 2009 (59/210 - 28.1%). CONCLUSION: The number of citations of articles published in Portuguese at Brazilian ophthalmology journals is lower than the published in English. The results of this study suggest that the editorial boards should strongly encourage the authors to adopt English as the main language in their future articles.