Which anatomical sites should be sampled for screening of methicillin-resistant Staphylococcus aureus carriage by culture or by rapid PCR test?

The nose is the anatomical site usually recommended for methicillin-resistant Staphylococcus aureus (MRSA) screening. Other sites are also recommended, but are more controversial. We showed that the sensitivities of MRSA detection from nasal swabs alone were 48% and 62% by culture or by rapid PCR test, respectively. These percentages increased to 79% and 92% with the addition of groin swabs, and to 96% and 99% with the addition of groin and throat swabs. In conclusion, neither by culture nor by rapid PCR test is nose sampling alone sufficient for MRSA detection. Additional anatomical sites should include at least the groin and throat.

Evaluation of the Duggan Test for Concretes Made of Different Types of Cements, MLR-97-8, 2000

In searching for simple and reliable test methods to evaluate the quality of Iowa portland cement concrete (PCC) pavements, the Duggan test was conducted for concretes made of twenty-six types of cements in this laboratory research. The influence of some factors, such as chemical composition and type of cements, use of air-entraining agent and water reducer, and water to cement ratio, on the result of the Duggan test was examined. It was found that the expansion increases with increasing values of potassium alkali (K2O) and sulfur trioxide (SO3) in cements. It was also found that the Type I cements generally produce higher expansion than the Type II, IP and IS cements. Since it is difficult to identify the major mechanism leading to the expansion observed in the Duggan test, more studies are certainly needed before it can be used as a reliable test method for evaluating the service life of concrete pavement.

Phosphorus in Finnish soils in the 1900s with particular reference to the acid ammonium acetate soil test

Selostus: Suomen maaperän fosforin tutkiminen 1900-luvulla ja viljavuustutkimuksen kehittäminen

La evaluación de corrección objetiva como instrumento de mejora en el aprendizaje de la història en bachillerato.

En este artículo se describe la investigación realizada por el grupo DHIGECS de la Universidad de Barcelona durante los años 2002, 2003 y 2004 . Esta línea de investigación se ha propuesto y se propone estudiar las relaciones entre la frecuencia de las pruebas de evaluación objetiva, consideradas fundamentalmente como actividades de aprendizaje, y los resultados obtenidos en la materia de Historia en el Bachillerato. Han participado en este trabajo 19 profesores y se ha trabajado con una muestra de 800 alumnos. Este artículo sigue en la línea iniciada en 1997 centrada en el aprendizaje de la historia en primer curso de ESO. Se presenta la problemática objeto de estudio, la metodología utilizada, el proceso de investigación seguido y se exponen algunos de los resultados obtenidos.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Soil Tracking Paint Test, MLR-89-13, 1989

A new paint testing device was built to determine the resistance of paints to darkening due to road grime being tracked onto them. The device consists of a tire rotating on a sample drum. Soil was applied to the tire and then tracked onto paint samples which were attached to the drum. A colorimeter was used to measure the lightness of the paints after being tracked. Lightness is measured from 0 (absolute black) to 100 (absolute white). Four experiments were run to determine the optimum time length to track a sample, the reproducibility, the effects of different soils, and the maximum acceptable level for darkening of a paint. The following conclusions were reached: 1) the optimum tracking time was 10 minutes; 2) the reproducibility had a standard deviation of 1.5 lightness units; 3) different soils did not have a large effect on the amount of darkening on the paints; 4) a maximum acceptable darkness could not be established based on the limited amount of data; and 5) a correlation exists between the paints which were darkening in the field and the paints which were turning the darkest on the tracking wheel.

Universidad y sociedad. Experiencias de aprendizaje servicio en la universidad

Rubio, L.; Prats, E.; Gómez, L. (coord.) Universidad y sociedad. Experiencias de aprendizaje servicio en la universidad. Barcelona, Universitat de Barcelona(Institut de Ciències de l’Educació), 2013.

Las dificultades del aprendizaje autónomo en un contexto de ABP

Objetivos: Identificar las dificultades que experimentan los estudiantes en un proceso de aprendizaje autodirigido. Elaborar un inventario y una clasificación de las dificultades identificadas. Diagnosticar las causas de las dificultades y apuntar vías o posibilidades de superación. Evaluar el impacto de las dificultades en el producto final. Datos del análisis empírico: Participan en el estudio un total de 80 estudiantes de los dos últimos cursos de la licenciatura de Derecho. Curso académico 2006-2007. Facultad de Derecho de la Universidad de Barcelona. Metodología de trabajo: estudio etnográfico. Resultados: para los estudiantes que no tienen experiencia previa en ABP la mayor dificultad es la desorientación y la angustia que sufren ante la ausencia de un temario. Existen dificultades de interacción con los tutores derivadas de la divergente concepción e inteligencia de significados. Finalmente, se han detectado dificultades derivadas de la influencia del entorno (hábitos personales) y otras conectadas con los estilos de aprendizaje de cada estudiante.

Evaluación continua a través del Moodle para involucrar al alumnado en su proceso de aprendizaje

El artículo presenta los resultados de un estudio orientado a conocer los efectos de un sistema de evaluación continua voluntaria usando la plataforma Moodle y un amplio banco de actividades, basadas en trabajos individuales y colaborativos, que el alumnado puede escoger. El objetivo de proponer este sistema de evaluación es doble. Por un lado, se persigue involucrar al alumnado ausente en el seguimiento de la evaluación continua mediante un entorno virtual. Por otro lado, se quiere motivar al alumnado en general en su aprendizaje a través de actividades continuas y orientadas a la práctica. El estudio se ha llevado a cabo en el contexto de una asignatura formada por dos grupos de los estudios de Administración y Dirección de Empresas de la Universidad de Barcelona. Como indicadores de bondad del sistema se han considerado la participación del alumnado en las actividades de evaluación y las notas finales. Los resultados han puesto de manifiesto la capacidad del sistema de involucrar al alumnado que asiste a clase en la realización de un mínimo de actividades y mejorar su aprendizaje, así como la incapacidad de involucrar significativamente al alumnado que no asiste a clase. Como conclusiones del estudio se apuntan la importancia de diseñar un buen modelo de feed-back y apostar más por tareas pensadas desde los enfoques de la evaluación auténtica.

Development of a Durability Test for Asphalts, May 1972

Research Project HR-124, "Development of a Laboratory Durability Test for Asphalts," was initiated in 1966 as a long-range comprehensive program. Its ultimate objective was to develop a simple, rapid laboratory test that could be used by highway engineers to select paving asphalt according to quality, to identify inferior asphalts, and to reasonably predict the useful life of asphalts once they were incorporated in the pavements.

Las TIC en el aula : Por un aprendizaje constructivo y significativo. Aplicación en alumnos de una USEE

Con este trabajo queremos demostrar que utilizando las TIC para el aprendizaje éste será más constructivo y significativo y con ello conseguiremos alumnos más motivados. Nos basaremos en las teorías construccionista y del aprendizaje significativo.

Cognición, emoción y aprendizaje

Qué significa aprender? ¿Cómo aprendemos? Si partimos de la etimología de la palabra “aprender”, nos damos cuenta de que proviene del concepto de “apoderarse”. Realmente aprendemos algo cuando nos apoderamos de ello. La neurociencia nos confirma la extrema plasticidad del cerebro. Según sus postulados, el cerebro se construye a sí mismo. Esto significa que para que realmente aprendamos algo, debe de producirse un “cambio” en el cerebro, es decir, en las conexiones que configuran las múltiples redes neuronales

Effects of alternative sets of climatic predictors on species distribution models and associated estimates of extinction risk: a test with plants in an arid environment

Aim To evaluate the effects of using distinct alternative sets of climatic predictor variables on the performance, spatial predictions and future projections of species distribution models (SDMs) for rare plants in an arid environment. . Location Atacama and Peruvian Deserts, South America (18º30'S - 31º30'S, 0 - 3 000 m) Methods We modelled the present and future potential distributions of 13 species of Heliotropium sect. Cochranea, a plant group with a centre of diversity in the Atacama Desert. We developed and applied a sequential procedure, starting from climate monthly variables, to derive six alternative sets of climatic predictor variables. We used them to fit models with eight modelling techniques within an ensemble forecasting framework, and derived climate change projections for each of them. We evaluated the effects of using these alternative sets of predictor variables on performance, spatial predictions and projections of SDMs using Generalised Linear Mixed Models (GLMM). Results The use of distinct sets of climatic predictor variables did not have a significant effect on overall metrics of model performance, but had significant effects on present and future spatial predictions. Main conclusion Using different sets of climatic predictors can yield the same model fits but different spatial predictions of current and future species distributions. This represents a new form of uncertainty in model-based estimates of extinction risk that may need to be better acknowledged and quantified in future SDM studies.

Bruce Treadmill Test in Children : First Normal Values for Children from Western Europe : P67

Introduction: One of the main goals for exereise testing in children is evaluation of exercise capacity. There are many testing protocols, but the Bruce treadmill protocol is widely used among pediatrie cardiology centers. Thirty years ago, Cuming et al. were the first to establish normal values for children from North America (Canada) aged 4 to 18 years old. No data was ever published for children from Western Europe. Our study aimed to assess the validity of the normal values from Cuming et al. for children from Western Europe in the 21 st century. Methods: It is a retrospective cohort study in a tertiary care children's hospital. 144 children referred to our institution but finally diagnosed as having a normal heart underwent exercise stress testing using the Bruce protocol between 1999 and 2006. Data from 59 girls and 85 boys aged 6 to 18 were reviewed. Mean endurance time (ET) for each age category and gender was compared with the mean normal values fram Cumming et al by an unpaired t-test. Results: Mean ET increases with age until 15 years old in girls and then decreases. Mean endurance time increases continuouslY'from 6 to 18 years old in boys. The increase is more pronounced in boys than girls. In our study, a significant higher mean ET was found for boys in age categories 10 to 12, 13 to 15 and 16 to 18. No significant difference was found in any other groups. Conclusions: Some normal values from Cuming et al. established in 1978 for ET with the Bruce protocol are probably not appropriate any more today for children from Western Europe. Our study showed that mean ET is higher for boys from 10 to 18 years old. Despite common beliefs, cardiovascular conditioning doesn't seem yet reduced in children from Western Europe. New data for Bruce treadmill exercise. testing for healthy children, 4 to 18 years old, living in Western Europe are required. .