985 resultados para histological analysis
Resumo:
The aim of the present study was to compare four methods of fixation in mandibular body fractures. Mechanical and photoelastic tests were performed using polyurethane and photoelastic resin mandibles, respectively. The study groups contained the following: (I), two miniplates of 2.0 mm; (II) one 2.0 mm plate and an Erich arch bar; (III) one 2.4 mm plate and an Erich arch bar, and (IV) one 2.0 mm plate and one 2.4 mm plate. The differences between the mean values were analyzed using Tukey's test, the Mann-Whitney test and the Bonferroni correction. Group II recorded the lowest resistance, followed by groups I, IV and III. The photoelastic test confirmed the increase of tension in group II. The 2.4 mm system board in linear mandibular body fractures provided more resistance and the use of only one 2.0 mm plate in the central area of the mandible created higher tension.
Resumo:
Chemical cross-linking has emerged as a powerful approach for the structural characterization of proteins and protein complexes. However, the correct identification of covalently linked (cross-linked or XL) peptides analyzed by tandem mass spectrometry is still an open challenge. Here we present SIM-XL, a software tool that can analyze data generated through commonly used cross-linkers (e.g., BS3/DSS). Our software introduces a new paradigm for search-space reduction, which ultimately accounts for its increase in speed and sensitivity. Moreover, our search engine is the first to capitalize on reporter ions for selecting tandem mass spectra derived from cross-linked peptides. It also makes available a 2D interaction map and a spectrum-annotation tool unmatched by any of its kind. We show SIM-XL to be more sensitive and faster than a competing tool when analyzing a data set obtained from the human HSP90. The software is freely available for academic use at http://patternlabforproteomics.org/sim-xl. A video demonstrating the tool is available at http://patternlabforproteomics.org/sim-xl/video. SIM-XL is the first tool to support XL data in the mzIdentML format; all data are thus available from the ProteomeXchange consortium (identifier PXD001677).
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
To evaluate pathologic features with implications on surgical radicality in women treated with radical hysterectomy and pelvic lymphadenectomy for cervical cancer stage IA1 with lymph vascular space invasion (LVSI) and stage IA2 by correlating findings in conization and hysterectomy specimens. Women with cervical cancer stage IA1 with LVSI and stage IA2 diagnosed by loop electrosurgical excisional procedure or cold knife conization were treated with radical hysterectomy and pelvic lymphadenectomy from January 1999 to December 2011 in 2 institutions. Fifty patients were enrolled: 40 with stage IA2 and 10 with stage IA1 with LVSI. Median age was 43 (30-67) years. All patients underwent cervical conization for diagnosis (45 loop electrosurgical excisional procedure, 5 cold knife). Lymph vascular space invasion was detected in 15 patients (30%). Two patients had positive pelvic nodes. No parametrial involvement was detected in the entire cohort. Positive margins were present in 35 patients, and residual disease was detected in 22 patients (44%). Positive margins predicted residual disease at radical hysterectomy (P = 0.02). Medium follow-up time was 51 months. One patient developed a pelvic recurrence, and there were no disease-related deaths. Patients with positive margins in cone biopsy specimens have an increased risk of residual disease at radical hysterectomy and require careful evaluation before conservative surgery. Pelvic lymph node evaluation is essential because lymph node metastasis may occur even in early stages. The lack of parametrial invasion in this study reinforces the knowledge that the select group of patients with microinvasive cervical carcinoma stages IA1 LVSI and stage IA2 have a very low risk of parametrial infiltration. Less radical surgery can be carefully considered for these patients.
Resumo:
The establishment of the most stable structures of eight membered rings is a challenging task to the field of conformational analysis. In this work, a series of 2-halocyclooctanones were synthesized (including fluorine, chlorine, bromine and iodine derivatives) and submitted to conformational studies using a combination of theoretical calculation and infrared spectroscopy. For each compound, four conformations were identified as the most important ones. These conformations are derived from the chair-boat conformation of cyclooctanone. The pseudo-equatorial (with respect to the halogen) conformer is preferred in vacuum and in low polarity solvents for chlorine, bromine and iodine derivatives. For 2-fluorocyclooctanone, the preferred conformation in vacuum is pseudo-axial. In acetonitrile, the pseudo-axial conformer becomes the most stable for the chlorine derivative. According to NBO calculations, the conformational preference is not dictated by electron delocalization, but by classical electrostatic repulsions.
Resumo:
Ameloblastic fibro-odontoma (AFO) is a slow-growing, expansive, benign odontogenic tumor, composed of ameloblastic epithelium embedded in an ectomesenchymal stroma resembling dental papilla, containing hard dental tissue in variable degrees of maturation, including enamel, dentin, and sometimes cementum. AFO typically affects the posterior mandible, causing bony expansion. We report a case of pigmented AFO in a 5-year-old boy, comprising clinical and histological features illustrated by immunohistochemistry using a large panel of antibodies, polarized light microscopy and scanning electron microscopy.
Resumo:
In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.
Resumo:
Lymphoma is the most common head and neck malignancy in children, and palatine tonsils asymmetry is the most frequent clinical manifestation of tonsillar lymphoma. However, several studies with children with tonsillar asymmetry found no case of lymphoma, showing that the relationship of tonsillar asymmetry with lymphoma is unclear. In this review, we aimed to identify the association between tonsillar asymmetry and tonsillar lymphoma in children by conducting systematic reviews of the literature on children with palatine tonsil lymphoma and tonsillar asymmetry. Articles comprising the paediatric age group (up to 18 years) with information concerning clinical manifestations of tonsillar lymphoma or the diagnosis of the tonsillar asymmetry were included. The main cause of asymmetry of palatine tonsils was lymphoid hyperplasia, followed by lymphoma and nonspecific benign changes. The asymmetry of tonsils was present in 73.2% of cases of lymphoma. There was an association between asymmetric palatine tonsils and lymphoma, with a likelihood ratio of 43.5 for children with asymmetry of palatine tonsils and 8938.4 for children with asymmetry of tonsils and other signs of suspicion for malignancy. We also provide recommendations on the management of suspicious cases of palatine tonsil lymphoma.
Resumo:
A flow injection method for the quantitative analysis of ketoconazole in tablets, based on the reaction with iron (III) ions, is presented. Ketoconazole forms a red complex with iron ions in an acid medium, with maximum absorbance at 495 nm. The detection limit was estimated to be 1×10--4 mol L-1; the quantitation limit is about 3×10--4 mol L-1 and approximately 30 determinations can be performed in an hour. The results were compared with those obtained with a reference HPLC method. Statistical comparisons were done using the Student's t procedure and the F test. Complete agreement was found at the 0.95 significance level between the proposed flow injection and the HPLC procedures. The two methods present similar precision, i.e., for HPLC the mean relative standard deviation was ca. 1.2% and for FIA ca. 1.6%.
Resumo:
The copolymer poly (L-co-D,L lactic acid), PLDLA, has gained prominence in the field of temporary prostheses due to the fact that their time of degradation is quite compatible with the requirement in the case of osseous fracture. In this work the in vivo degradation of devices from copolymer, as a system of plates and screws, used in fixation of the tibia of rabbits was studied. The devices were implanted in 15 adult rabbits, albinos, New Zealand race, and they were used as control devices of alloys of titanium (Ti-6Al-4V/ V grade). The use of copolymers, synthesized in the laboratory, was tested in the repair of fracture in rabbits'tibias, being assessed in the following times: 2 weeks, 2 months and 3 months. Morphological analysis of tissue surrounding the plate and screw system, for 2 weeks of implantation, showed the presence of osteoblasts, indicating a pre bone formation. After 2 months there was new bone formation in the region in contact with the polymer. This bone growth occurred simultaneously with the process of PLDLA degradation, invading the region where there was polymer and after 3 months there was an intense degradation of the copolymer and hence greater tissue invasion compared to 2 months which characterized bone formation in a region where the polymer degraded. The in vivo degradation study of the devices for PLDLA by means of histological evaluations during the period of consolidation of the fracture showed the efficiency of plate and screw system, and it was possible to check formation of bone tissue at the implantation site, without the presence of inflammatory reaction
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
OBJECTIVE: To screen for mutations in AMH and AMHR2 genes in patients with persistent Müllerian duct syndrome (PMDS). PATIENTS AND METHOD: Genomic DNA of eight patients with PMDS was obtained from peripheral blood leukocytes. Directed sequencing of the coding regions and the exon-intron boundaries of AMH and AMHR2 were performed. RESULTS: The AMH mutations p.Arg95*, p.Arg123Trp, c.556-2A>G, and p.Arg502Leu were identified in five patients; and p.Gly323Ser and p.Arg407* in AMHR2 of two individuals. In silico analyses of the novel c.556-2A>G, p.Arg502Leu and p.Arg407* mutations predicted that they were harmful and were possible causes of the disease. CONCLUSION: A likely molecular etiology was found in the eight evaluated patients with PMDS. Four mutations in AMH and two in AMHR2 were identified. Three of them are novel mutations, c.556-2A>G, and p.Arg502Leu in AMH; and p.Gly323Ser in AMHR2. Arq Bras Endocrinol Metab. 2012;56(8):473-8
Resumo:
233
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física