995 resultados para adesão à medicação
Resumo:
In order to evaluate the psychological variables that affect sexual dysfunction (SD) in epilepsy, where compared 60 epileptics (Group 1) with 60 healthy individuals (Group 2), through the State-Trait Anxiety Inventory (Spielberger et al., 1970), Beck Depression Inventory (Beck, 1974) and Sexual Behavior Interview (Souza, 1995). Sexual dysfunction (SD), anxiety and depression were found more frequently in Group 1 than in Group 2 and were not related to sex. Variables such as the onset duration and frequency of seizures as well as the use to medication were not associated with SD. Temporal lobe epilepsy was related to SD (p = 0.035) but not to anxiety or depression. Anxiety and depression were related to SD in both groups. Perception in controlling the seizures was closely related to anxiety (p = 0) and depression (p = 0.009). We conclude that psychological factors play an important role in the alteration of sexual behavior in epileptics and that suitable attention must be given to the control of these variables.
Resumo:
OBJECTIVE: To investigate the clinical and genetic characteristics of familial partial epilepsies. METHOD: Family history of seizures was questioned in all patients followed in our epilepsy clinics, from October 1997 to December 1998. Those with positive family history were further investigated and detailed pedigrees were obtained. All possibly affected individuals available underwent clinical evaluation. Seizures and epilepsy syndromes were classified according to the ILAE recommendations. Whenever possible, EEG and MRI were performed. RESULTS: Positive family history was identified in 32 unrelated patients. A total of 213 possibly affected individuals were identified, 161 of whom have been evaluated. The number of affected subjects per family ranged from two to 23. Temporal lobe epilepsy (TLE) was identified in 22 families (68%), frontal lobe epilepsy in one family (3%), partial epilepsy with centrotemporal spikes in five families (15%), and other benign partial epilepsies of childhood in four families (12%). Most of the affected individuals in the TLE families (69%) had clinical and/or EEG characteristics of typical TLE. However, the severity of epilepsy was variable, with 76% of patients with spontaneous seizure remission or good control with medication and 24% with refractory seizures, including 7 patients that underwent surgical treatment. In the other 10 families, we identified 39 possibly affected subjects, 23 of whom were evaluated. All had good seizure control (with or without medication) except for one patient with frontal lobe epilepsy. Pedigree analysis suggested autosomal dominant inheritance with incomplete penetrance in all families. CONCLUSION: Family history of seizures is frequent among patients with partial epilepsies. The majority of our families had TLE and its expression was not different from that observed in sporadic cases. The identification of genes involved in partial epilepsies may be usefull in classification of syndromes, to stablish prognosis and optimal treatment.
Resumo:
We report the case of a 73-year-old female who presented facial numbness and pain in the first division of the trigeminal nerve, ptosis, diplopia and visual loss on the right side for the previous four months. The neurological, radiological and histological examination demonstrated a rare case of invasive fungal aspergillosis of the central nervous system, causing orbital apex syndrome, later transformed in temporal brain abscess. She died ten months later due to respiratory and renal failure in spite of specific antimycotic therapy.
Resumo:
We report on two epileptic patients who developed acute psychosis after the use of topiramate (TPM). One patient exhibited severe psychomotor agitation, heteroaggressiveness, auditory and visual hallucinations as well as severe paranoid and mystic delusions. The other patient had psychomotor agitation, depersonalization, derealization, severe anxiety and deluded that he was losing his memory. Both patients had to be taken to the casualty room. After interruption of TPM in one patient and reduction of dose in the other, a full remission of the psychotic symptoms was obtained without the need of antipsychotic drugs. Clinicians should be aware of the possibility of development of acute psychotic symptoms in patients undergoing TPM treatment.
Resumo:
The aim of this study was to analyze the prevalence of hypertension and control practices among the elderly. The survey analyzed data from 872 elderly people in São Paulo, Brazil, through a cluster sampling, stratified according to education and income. A Poisson multiple regression model checked for the existence of factors associated with hypertension. The prevalence of self-reported hypertension among the elderly was 46.9%. Variables associated with hypertension were self-rated health, alcohol consumption, gender, and hospitalization in the last year, regardless of age. The three most common measures taken to control hypertension, but only rarely, are oral medication, routine salt-free diet and physical activity. Lifestyle and socioeconomic status did not affect the practice of control, but knowledge about the importance of physical activity was higher among those older people with higher education and greater income. The research suggests that health policies that focus on primary care to encourage lifestyle changes among the elderly are necessary.
Resumo:
Dental materials that release fluoride have been shown to be effective in caries inhibition around restorations. Adhesive materials would also be effective in caries inhibition by sealing and protecting cavity margins from acidic demineralization. This in vitro study tested the hypothesis that composite restorations with a dentin adhesive system have a caries preventive effect similar to that of an adhesive material with fluoride - glass-ionomer cement - on root surfaces. Twenty roots from extracted sound third molars were embedded in polystyrene resin and ground flat. Standardized cavities were prepared in leveled root surfaces and randomly restored with (a) Chelon-Fil (Espe) or (b) Z100/SingleBond (3M). Baseline indentations were measured at 100, 200 and 300 mum from the occlusal margins of each restoration and the surface microhardness values were obtained using a Knoop diamond indenter. A 2.0 mm wide margin around the restorations was submitted to a pH-cycling model, at 37ºC. After that, surface microhardness was measured again, as it was before. The differences between baseline and final surface microhardness were considered for statistical analysis. The median values of differences were (a): -3.8; -0.3; -1.0; and (b): 3.3; 2.5; 1.7, for the distances of 100, 200 and 300 mum, respectively. The Kruskal-Wallis test did not show statistically significant difference between 100, 200 and 300 mum distances in each tested group. There was no difference between the studied materials at the distances of 200 and 300 mum. Chelon-Fil was statistically different from Z100/SingleBond, at 100 mum (p<0.05). Under the studied conditions, the glass-ionomer cement had a higher caries preventive effect than the composite/dentin adhesive restorations.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Purpose: Amblyopia is the most common form of visual problem in children and for more than 250 years occlusion therapy is the standard treatment. Thus our purpose is to identify the factors that influence the outcome of amblyopia treatment with occlusion therapy. Methods: We reviewed 169 amblyopic children seen in the outpatient clinic of amblyopia of the Campinas State University, between January 1996 and May 1998. Patients were analyzed regar-ding sex, age at start of treatment (3 groups), affected eye, type of amblyopia (strabismic, anisometropic, visual depri-vation, associated), follow-up, initial visual acuity (light, moderate, severe), compliance with treatment (good, poor) and outcome (fully treated, partially treated, not treated). Results: Compliance was not seen to be significantly related to age at start of treatment (p=0.68) or initial visual acuity (p=0.82). 52.67% of the patients were fully treated while 19.52% were partially treated and 27.81% were not treated. Children recorded as showing good compliance had a significantly better outcome than those with poor complian-ce (p=0.0009). Neither the age at start of treatment (p=0.39) nor the initial visual acuity (p=0.30) were significantly corre-lated with the final outcome. Conclusions: We concluded that the main factor affecting the final outcome of amblyopia treatment is compliance.
Resumo:
Purpose: An experimental study to evaluate the behavior of polytetrafluoroethylene (Gore-Tex®) compared with human sclera, in scleral perforations induced in rabbits eyes was performed. Methods: Twenty-two eyes of rabbits were submitted to scleral perforation followed by Gore-Tex® graft in the left eye and human sclera graft in the right eye respectively. During one month the postoperative evolution was analyzed every day: intensity of hyperemia, presence of infection, secretion, rejection and tonicity of the eyes. Results: No cases of secretion, infection or rejection were observed. The histological sections showed fibrosis in the eyes with Gore-Tex®, good adhesion and epithelization. Conclusion: The Gore-Tex® showed to be a plausible material to be used as graft in scleral defects with some advantages such as easy obtention, good handling and durability.
Resumo:
PURPOSE: To evaluate changes in retinal nerve fiber layer thickness as measured by scanning laser polarimetry (SLP) after the use of medication to reduce intraocular pressure (IOP) in glaucomatous or ocular hypertensive patients. METHODS: The authors prospectively enrolled 37 eyes of 37 patients in whom IOP was reduced by more than 25% after the use of medication. The images were obtained before and 15 to 30 days after the introduction of medication. The SLP parameters measured before and after the use of medication were compared using paired Student's t Test. RESULTS: The mean IOP was significantly reduced from 26.57±4.23 mmHg to 16.54 ±2.92 mmHg after the use of medication (p<0.05). None of the 10 SLP analyzed parameters was significantly affected by the reduction of IOP with medication (p>0.05). CONCLUSION: The retinal nerve fiber layer thickness, as measured by SLP, is not affected by the reduction of IOP with medication in patients with glaucoma or ocular hypertension.
Resumo:
The authors analysed 34 cases of resistant epilepsy (20 males and 14 females, mean age 23 years), treated clinically between February/1984 and May/1986. The patients underwent neurological, neuropsychological, psychological, psychiatric, cerebrospinal fluid, electroencephalographic, tomographic and/or angiographic examination. Most of the patients had complex partial seizures. The etiology was unknown in 19 patients (55.8%), probable neurocysticercosis in 6, perinatal hypoxia in 5, delivery trauma in 3 and probable sequelae of encephalitis in 2 patients. There was a clear past history of infantile febrile convulsion in 2 patients. Most patients received carbamazepine (mean dose 24.5 mg/kg/day), phenytoin (5 mg/kg and valproic acid (28 mg/kg) as monotherapy or in association. Twenty-two patients (64.7%) had more than 80% decrease of the seizure frequency. Nine resistant epilepsy-cases (24.5%) were evaluated as candidates for surgical therapy. The authors concluded that the resistant epilepsy is best managed by a specialised, multidisciplinary team, and pointed out the need of a correct diagnosis of the seizure type, an adequate drug therapy and a good engagement of the patient and his family in the treatment.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
INTRODUÇÃO: apesar da colagem direta despender menor tempo clínico, com maior preservação da integridade gengival, ainda hoje se observa uma alta incidência de bandagem dos molares. Portanto, torna-se interessante a idealização de recursos para o aumento da eficiência desse procedimento para dentes submetidos a maiores impactos mastigatórios, como, por exemplo, os molares. OBJETIVO: esse estudo teve o propósito de avaliar se a resistência à adesão com a aplicação de uma camada de resina adicional na região oclusal da interface tubo/dente aumenta a qualidade do procedimento de colagem direta de tubos em molares. MÉTODOS: selecionou-se uma amostra composta por 40 terceiros molares inferiores, que foram aleatoriamente divididos em 2 grupos: Grupo 1 - colagem direta convencional, seguida pela aplicação de uma camada de resina na oclusal da interface tubo/dente; e Grupo 2 - colagem direta convencional. O teste de resistência ao cisalhamento foi realizado 24 horas após a colagem, utilizando-se uma máquina de ensaio universal, operando a uma velocidade de 0,5mm/min. Os resultados foram analisados por meio do teste t independente. RESULTADOS: os valores médios obtidos nos testes de cisalhamento foram: 17,08MPa para o Grupo 1 e 12,60MPa para o Grupo 2. O Grupo 1 apresentou uma resistência ao cisalhamento estatisticamente significativa mais alta do que o Grupo 2. CONCLUSÃO: a aplicação de uma camada adicional de resina na oclusal da interface tubo/dente aumenta a qualidade da adesão do procedimento de colagem direta de tubos ortodônticos em molares.