Clinicopathological And Immunohistochemical Evaluation Of Oral And Oropharyngeal Squamous Cell Carcinoma In Chilean Population.

In oral and oropharyngeal squamous cell carcinoma (OCSCC and OPSCC) exist an association between clinical and histopathological parameters with cell proliferation, basal lamina, connective tissue degradation and surrounding stroma markers. We evaluated these associations in Chilean patients. A convenience sample of 37 cases of OCSCC (n=16) and OPSCC (n=21) was analyzed clinically (TNM, clinical stage) and histologically (WHO grade of differentiation, pattern of tumor invasion). We assessed the expression of p53, Ki67, HOXA1, HOXB7, type IV collagen (ColIV) and carcinoma-associated fibroblast (α-SMA-positive cells). Additionally we conducted a univariate/bivariate analysis to assess the relationship of these variables with survival rates. Males were mostly affected (56.2% OCSCC, 76.2% OPSCC). Patients were mainly diagnosed at III/IV clinical stages (68.8% OCSCC, 90.5% OPSCC) with a predominantly infiltrative pattern invasion (62.9% OCSCC, 57.1% OPSCC). Significant association between regional lymph nodes (N) and clinical stage with OCSCC-HOXB7 expression (Chi-Square test P < 0.05) was observed. In OPSCC a statistically significant association exists between p53, Ki67 with gender (Chi-Square test P < 0.05). In OCSCC and OPSCC was statistically significant association between ki67 with HOXA1, HOXB7, and between these last two antigens (Pearson's Correlation test P < 0.05). Furthermore OPSCC-p53 showed significant correlation when it was compared with α-SMA (Kendall's Tau-c test P < 0.05). Only OCSCC-pattern invasion and OPSCC-primary tumor (T) pattern resulted associated with survival at the end of the follow up period (Chi-Square Likelihood Ratio, P < 0.05). Clinical, histological and immunohistochemical features are similar to seen in other countries. Cancer proliferation markers were associated strongly from each other. Our sample highlights prognostic value of T and pattern of invasion, but the conclusions may be limited and should be considered with caution (small sample). Many cases were diagnosed in the advanced stages of the disease, which suggests that the diagnosis of OCSCC and OPSCC is made late.

Evaluation Of Soft-tissue Lesions With (18)f-fdg Pet/ct: Initial Results Of A Prospective Trial.

Although MRI is utilized for planning the resection of soft-tissue tumors, it is not always capable of differentiating benign from malignant lesions. The risk of local recurrence of soft-tissue sarcomas is increased when biopsies are performed before resection and by inadequate resections. PET associated with computed tomography using fluorodeoxyglucose labeled with fluorine-18 ((18)F-FDG PET/CT) may help differentiate between benign and malignant tumors, thus avoiding inadequate resections and making prior biopsies unnecessary. The purpose of this study was to evaluate the usefulness of (18)F-FDG PET/CT in differentiating benign from malignant solid soft-tissue lesions. Patients with solid lesions of the limbs or abdominal wall detected by MRI were submitted to (18)F-FDG PET/CT. The maximum standardized uptake value (SUVmax) cutoff was determined to differentiate malignant from benign tumors. Regardless of the (18)F-FDG PET/CT results all patients underwent biopsy and surgery. MRI was performed in 54 patients, and 10 patients were excluded because of purely lipomatose or cystic lesions. (18)F-FDG PET/CT was performed in the remaining 44 patients. Histopathology revealed 26 (59%) benign and 18 (41%) malignant soft-tissue lesions. A significant difference in SUVmax was observed between benign and malignant soft-tissue lesions. The SUVmax cutoff of 3.0 differentiated malignant from benign lesions with 100% sensitivity, 83.3% specificity, 89.6% accuracy, 78.3% positive predictive value, and 100% negative predictive value. (18)F-FDG PET/CT seems to be able to differentiate benign from malignant soft-tissue lesions with good accuracy and very high negative predictive value. Incorporating (18)F-FDG PET/CT into the diagnostic algorithm of these patients may prevent inadequate resections and unnecessary biopsies.

Tissue Microarray Is A Reliable Method For Immunohistochemical Analysis Of Pleomorphic Adenoma.

To determine the most adequate number and size of tissue microarray (TMA) cores for pleomorphic adenoma immunohistochemical studies. Eighty-two pleomorphic adenoma cases were distributed in 3 TMA blocks assembled in triplicate containing 1.0-, 2.0-, and 3.0-mm cores. Immunohistochemical analysis against cytokeratin 7, Ki67, p63, and CD34 were performed and subsequently evaluated with PixelCount, nuclear, and microvessel software applications. The 1.0-mm TMA presented lower results than 2.0- and 3.0-mm TMAs versus conventional whole section slides. Possibly because of an increased amount of stromal tissue, 3.0-mm cores presented a higher microvessel density. Comparing the results obtained with one, two, and three 2.0-mm cores, there was no difference between triplicate or duplicate TMAs and a single-core TMA. Considering the possible loss of cylinders during immunohistochemical reactions, 2.0-mm TMAs in duplicate are a more reliable approach for pleomorphic adenoma immunohistochemical study.

Perivascular Adipose Tissue And Vascular Responses In Healthy Trained Rats.

125

Jnk And Ikkβ Phosphorylation Is Reduced By Glucocorticoids In Adipose Tissue From Insulin-resistant Rats.

Peripheral insulin resistance (IR) is one of the main side effects caused by glucocorticoid (GC)-based therapies, and the molecular mechanisms of GC-induced IR are not yet fully elucidated. Thus, we aimed to investigate the effects of dexamethasone treatment on the main components of insulin and inflammatory signaling in the adipose tissue of rats. Male Wistar rats received daily injections of dexamethasone (1mg/kg body weight (b.w.), intraperitoneally (i.p.)) for 5 days (DEX), whereas control rats received saline (CTL). The metabolic status was investigated, and the epididymal fat fragments were collected for lipolysis and western blot analyses. The DEX rats became hyperglycemic, hyperinsulinemic, insulin resistant and glucose intolerant, compared with the CTL rats (P<0.05). The basal glycerol release in the fat fragments was 1.5-fold higher in the DEX rats (P<0.05). The phosphorylation of protein kinase B (PKB) at ser(473) decreased by 44%, whereas, the phosphorylation of insulin receptor substrate (IRS)-1 at ser(307) increased by 93% in the adipose tissue of the DEX rats after an oral bolus of glucose (P<0.05). The basal phosphorylation of c-jun-N-terminal kinase (JNK) and inhibitor of nuclear factor kappa-B (IKKβ) proteins was reduced by 46% and 58%, respectively, in the adipose tissue of the DEX rats (P<0.05). This was paralleled with a significant reduction (47%) in the glucocorticoid receptor (GR) protein content in the adipose tissue of the DEX rats (P<0.05). The insulin-resistant status of rats induced by dexamethasone administration have PKB and IRS-1 activity attenuated in epididymal fat without increases in the phosphorylation of the proinflammatory signals JNK and IKKβ.

A Leucine-rich Diet Modulates The Tumor-induced Down-regulation Of The Mapk/erk And Pi3k/akt/mtor Signaling Pathways And Maintains The Expression Of The Ubiquitin-proteasome Pathway In The Placental Tissue Of Nmri Mice.

Placental tissue injury is concomitant with tumor development. We investigated tumor-driven placental damage by tracing certain steps of the protein synthesis and degradation pathways under leucine-rich diet supplementation in MAC16 tumor-bearing mice. Cell signaling and ubiquitin-proteasome pathways were assessed in the placental tissues of pregnant mice, which were distributed into three groups on a control diet (pregnant control, tumor-bearing pregnant, and pregnant injected with MAC-ascitic fluid) and three other groups on a leucine-rich diet (pregnant, tumor-bearing pregnant, and pregnant injected with MAC-ascitic fluid). MAC tumor growth down-regulated the cell-signaling pathways of the placental tissue and decreased the levels of IRS-1, Akt/PKB, Erk/MAPK, mTOR, p70S6K, STAT3, and STAT6 phosphorylated proteins, as assessed by the multiplex Millipore Luminex assay. Leucine supplementation maintained the levels of these proteins within the established cell-signaling pathways. In the tumor-bearing group (MAC) only, the placental tissue showed increased PC5 mRNA expression, as assessed by quantitative RT-PCR, decreased 19S and 20S protein expression, as assessed by Western blot analysis, and decreased placental tyrosine levels, likely reflecting up-regulation of the ubiquitin-proteasome pathway. Similar effects were found in the pregnant injected with MAC-ascitic fluid group, confirming that the effects of the tumor were mimicked by MAC-ascitic fluid injection. Although tumor progression occurred, the degradation pathway-related protein levels were modulated under leucine-supplementation conditions. In conclusion, tumor evolution reduced the protein expression of the cell-signaling pathway associated with elevated protein degradation, thereby jeopardizing placental activity. Under the leucine-rich diet, the impact of cancer on placental function could be minimized by improving the cell-signaling activity and reducing the proteolytic process.

Application Of Laser Microdissection Icp-ms For High Resolution Elemental Mapping In Mouse Brain Tissue: A Comparative Study With Laser Ablation Icp-ms.

Mapping of elements in biological tissue by laser induced mass spectrometry is a fast growing analytical methodology in life sciences. This method provides a multitude of useful information of metal, nonmetal, metalloid and isotopic distribution at major, minor and trace concentration ranges, usually with a lateral resolution of 12-160 µm. Selected applications in medical research require an improved lateral resolution of laser induced mass spectrometric technique at the low micrometre scale and below. The present work demonstrates the applicability of a recently developed analytical methodology - laser microdissection associated to inductively coupled plasma mass spectrometry (LMD ICP-MS) - to obtain elemental images of different solid biological samples at high lateral resolution. LMD ICP-MS images of mouse brain tissue samples stained with uranium and native are shown, and a direct comparison of LMD and laser ablation (LA) ICP-MS imaging methodologies, in terms of elemental quantification, is performed.

Magnetic resonance imaging in the evaluation of patients with aseptic meningoencephalitis and connective tissue disorders

OBJECTIVE: To describe the role of magnetic resonance imaging (MRI) in the evaluation of patients with chronic and recurrent aseptic meningitis.METHOD: A retrospective study of five patients with aseptic meningoencefalitis diagnosed by clinical and CSF findings. CT scans showed without no relevant findings. RESULTS: MRI showed small multifocal lesions hyperintense on T2 weighted images and FLAIR, with mild or no gadolinium enhancement, mainly in periventricular and subcortical regions. Meningoencephalitis preceded the diagnosis of the underlying disease in four patients (Behçet´s disease or systemic lupus erythematosus). After the introduction of adequate treatment for the rheumatic disease, they did not present further symptoms of aseptic meningoencephalitis. CONCLUSION: Aseptic meningoencephalitis can be an early presentation of an autoimmune disease. It is important to emphasize the role of MRI in the diagnosis and follow-up of these patients.

Tissue culture of Cecropia glaziovii Sneth (urticaceae): vegetative micropropagation and plant regeneration from callus

Cecropia glaziovii is a tree with used in Brazilian popular medicine. Methods allowing the clonal propagation of this species are of great interest for superior genotype multiplication and perpetuation. For this reason, we examined the effect of different culture media and different types of explants on adventitious shoot regeneration from callus and buds of C. glaziovii. Leaves, petioles and stipules obtained from aseptically grown seedlings or from pre-sterilized plants were used to initiate cultures. Adventitious shoot regeneration was achieved when apical and axillary buds were inoculated on gelled Murashige & Skoog (MS) medium supplemented with 6-benzylaminopurine alone (BAP) (1.0, 5.0 or 10.0 mg L-1) or combined with -naphthalene acetic acid (NAA) (1.0 or 2.0 mg L-1), after 40 days of culture. Best callus production was obtained after 30 days of petioles' culture on gelled MS medium with 2,4 dichlorophenoxyacetic acid (2,4-D) (5.0 mg L-1) combined with BAP (1.0 mg L-1). Successful shoot regeneration from callus was achieved when MS medium supplemented with zeatin (ZEA) (0.1 mg L-1) alone or combined with 2,4-D (1.0 or 5.0 mg L-1) was inoculated with friable callus obtained from petioles. All shoots were rooted by inoculation on MS medium supplemented with indole-3-acetic acid (IAA) (1.0 mg L-1). Rooted plants transferred to potting soil were successfully established. All in vitro regenerated plantlets showed to be normal, without morphological variations, being also identical to the source plant. Our study has shown that C. glaziovii can be propagated by tissue culture methods, allowing large scale multiplication of superior plants for pharmacological purposes.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Paramentros fisiologicos, motores e morfologicos de bailarinas classicas

Universidade Estadual de Campinas . Faculdade de Educação Física

Efeito do treinamento e maturação sexual sobre o crescimento, composição corporal e desempenho motor em adolescentes do sexo masculino

Universidade Estadual de Campinas . Faculdade de Educação Física

Pulp tissue from primary teeth: new source of stem cells

SHED (stem cells from human exfoliated deciduous teeth) represent a population of postnatal stem cells capable of extensive proliferation and multipotential differentiation. Primary teeth may be an ideal source of postnatal stem cells to regenerate tooth structures and bone, and possibly to treat neural tissue injury or degenerative diseases. SHED are highly proliferative cells derived from an accessible tissue source, and therefore hold potential for providing enough cells for clinical applications. In this review, we describe the current knowledge about dental pulp stem cells and discuss tissue engineering approaches that use SHED to replace irreversibly inflamed or necrotic pulps with a healthy and functionally competent tissue that is capable of forming new dentin.

A comparison of skeletal, dentoalveolar and soft tissue characteristics in white and black Brazilian subjects

OBJECTIVE: This study aimed to compare skeletal, dentoalveolar and soft tissue characteristics in white and black Brazilian subjects presenting normal occlusions. MATERIAL AND METHODS: The sample comprised the lateral cephalograms of 106 untreated Brazilian subjects with normal occlusion, divided into two groups: Group 1- 50 white subjects (25 of each gender), at a mean age of 13.17 years (standard deviation 1.07); and Group 2- 56 black subjects (28 of each gender), at a mean age of 13.24 years (standard deviation 0.56). Variables studied were obtained from several cephalometric analyses. Independent t tests were used for intergroup comparison and to determine sexual dimorphism. RESULTS: black subjects presented a more protruded maxilla and mandible, a smaller chin prominence and a greater maxillomandibular discrepancy than white subjects. Blacks presented a more horizontal craniofacial growth pattern than whites. Maxillary and mandibular incisors presented more protruded and proclined in black subjects. The nasolabial angle was larger in whites. Upper and lower lips were more protruded in blacks than in whites. CONCLUSIONS: The present study found a bimaxillary skeletal, dentoalveolar and soft tissue protrusion in black Brazilian subjects compared to white Brazilian subjects, both groups with normal occlusion. Upper and lower lips showed to be more protruded in blacks, but lip thickness was similar in both groups.

Subcutaneous connective tissue response to primary root canal filling materials

This study evaluated the response of the subcutaneous connective tissue of BALB/c mice to root filling materials indicated for primary teeth: zinc oxide/eugenol cement (ZOE), Calen paste thickened with zinc oxide (Calen/ZO) and Sealapex sealer. The mice (n=102) received polyethylene tube implants with the materials, thereby forming 11 groups, as follows: I, II, III: Calen/ZO for 7, 21 and 63 days, respectively; IV, V, VI: Sealapex for 7, 21 and 63 days, respectively; VII, VIII, IX: ZOE for 7, 21 and 63 days, respectively; X and XI: empty tube for 7 and 21 days, respectively. The biopsied tissues were submitted to histological analysis (descriptive analysis and semi-quantitative analysis using a scoring system for collagen fiber formation, tissue thickness and inflammatory infiltrate). A quantitative analysis was performed by measuring the area and thickness of the granulomatous reactionary tissue (GRT). Data were analyzed by Kruskal-Wallis, ANOVA and Tukey's post-hoc tests (?=0.05). There was no significant difference (p>0.05) among the materials with respect to collagen fiber formation or GRT thickness. However, Calen/ZO produced the least severe inflammatory infiltrate (p<0.05). The area of the GRT was significantly smaller (p<0.05) for Calen/ZO and Sealapex. In conclusion, Calen/ZO presented the best tissue reaction, followed by Sealapex and ZOE.