Improved serodiagnosis of alveolar echinococcosis of humans using an in vitro-produced Echinococcus multilocularis antigen

Serology is an important tool for the diagnosis of alveolar echinococcosis (AE) in humans. In order to improve serodiagnostic performance, we have developed an in vitro-produced Echinococcus mulilocularis metacestode vesicle fluid (EmVF) antigen for application in an immunoblot assay. Immunoblot analysis of EmVF revealed an abundant immunoreactive band triplet of 20-22 kDa, achieving a sensitivity of 100% based on the testing of sera from 62 pre-operative and pre-treatment cases of active and inactive AE. Thus, the EmVF-immunoblotting allowed the specific detection of cases seronegative by the Em2- and/or EmII/3-10-ELISA, usually attributable to abortive, inactive cases of AE. The specificity of the EmVF-immunoblotting did not allow discrimination between AE and cystic echinococcosis (CE) but was 100% with respect to non-Echinococcus parasitic infections or cancer malignancies. Based on the findings of this study, it is recommended that the current ELISA test combination (Em2- and II/3-10-ELISA) be complemented with EmVF-immunoblotting, allowing an improved diagnosis of both clinical and subclinical forms of AE, including those associated with E. multilocularis-specific antibody reactivities not detectable by ELISA.

The Family Pasteurellaceae

This chapter describes the systematics and evolution of Pasteurellaceae with emphasis on new information generated since the 3rd edition of The Prokaryotes which only included chapters dealing with Haemophilus, Actinobacillus, and Pasteurella. A major source of new information for the current chapter has been provided by whole genome sequences now available for many taxa of the family. Some 100 species and species-like taxa have been documented and 18 genera of Pasteurellaceae reported so far. Members of the family include specialized commensals, potential pathogens, or pathogens of vertebrates and mainly survive poorly in other habitats including the external environment. The pathogenic members are of major importance to animal production and human health. Members of Pasteurellaceae have relatively small genomes, probably as a result of adaption to a special habitat. The most important species in veterinary microbiology include Pasteurella multocida, Actinobacillus pleuropneumoniae, [Haemophilus] parasuis, Mannheimia haemolytica, Bibersteinia trehalosi, and Avibacterium paragallinarum, while Haemophilus influenzae and Aggregatibacter actinomycetemcomitans represent the most important species as to human disease. Traditional isolation techniques are still used in both human and veterinary clinical diagnostic laboratories although genetically based diagnostic methods have replaced traditional biochemical/physiological methods for characterization and identification. For all species, MALDI-TOF can now be used as a diagnostic tool. As control and if MALDI-TOF equipment is not at hand, PCR-based specific detection is possible for Pasteurella multocida, Actinobacillus pleuropneumoniae, [Haemophilus] parasuis, Mannheimia haemolytica, Avibacterium paragallinarum, Gallibacterium anatis, Haemophilus influenzae, and Aggregatibacter actinomycetemcomitans. A lot of work has been directed towards identification of virulence factors and understanding host microbe interactions involved in disease.

First international external quality assessment of molecular diagnostics for Mers-CoV

BACKGROUND: Since the discovery of Middle East respiratory syndrome coronavirus (MERS-CoV) in 2012, diagnostic protocols were quickly published and deployed globally. OBJECTIVES: We set out to assess the quality of MERS-CoV molecular diagnostics worldwide. STUDY DESIGN: Both sensitivity and specificity were assessed using 12 samples containing different viral loads of MERS-CoV or common coronaviruses (OC43, 229E, NL63, HKU1). RESULTS: The panel was sent to more than 106 participants, of which 99 laboratories from 6 continents returned 189 panel results.Scores ranged from 100% (84 laboratories) to 33% (1 laboratory). 15% of respondents reported quantitative results, 61% semi-quantitative (Ct-values or time to positivity) and 24% reported qualitative results. The major specific technique used was real-time RT-PCR using the WHO recommended targets upE, ORF1a and ORF1b. The evaluation confirmed that RT-PCRs targeting the ORF1b are less sensitive, and therefore not advised for primary diagnostics. CONCLUSIONS: The first external quality assessment MERS-CoV panel gives a good insight in molecular diagnostic techniques and their performances for sensitive and specific detection of MERS-CoV RNA globally. Overall, all laboratories were capable of detecting MERS-CoV with some differences in sensitivity. The observation that 8% of laboratories reported false MERS-CoV positive single assay results shows room for improvement, and the importance of using confirmatory targets.

NS1 protein secretion during the acute phase of West Nile virus infection

The West Nile virus (WNV) nonstructural protein NS1 is a protein of unknown function that is found within, associated with, and secreted from infected cells. We systematically investigated the kinetics of NS1 secretion in vitro and in vivo to determine the potential use of this protein as a diagnostic marker and to analyze NS1 secretion in relation to the infection cycle. A sensitive antigen capture enzyme-linked immunosorbent assay (ELISA) for detection of WNW NS1 (polyclonal-ACE) was developed, as well as a capture ELISA for the specific detection of NS1 multimers (4G4-ACE). The 4G4-ACE detected native NS1 antigens at high sensitivity, whereas the polyclonal-ACE had a higher specificity for recombinant forms of the protein. Applying these assays we found that only a small fraction of intracellular NS1 is secreted and that secretion of NS1 in tissue culture is delayed compared to the release of virus particles. In experimentally infected hamsters, NS1 was detected in the serum between days 3 and 8 postinfection, peaking on day 5, the day prior to the onset of clinical disease; immunoglobulin M (IgM) antibodies were detected at low levels on day 5 postinfection. Although real-time PCR gave the earliest indication of infection (day 1), the diagnostic performance of the 4G4-ACE was comparable to that of real-time PCR during the time period when NS1 was secreted. Moreover, the 4G4-ACE was found to be superior in performance to both the IgM and plaque assays during this time period, suggesting that NS1 is a viable early diagnostic marker of WNV infection.

Label-free immunoassay for porcine circovirus type 2 based on excessively tilted fiber grating modified with staphylococcal protein A

Using excessively tilted fiber grating (Ex-TFG) inscribed in standard single mode fiber, we developed a novel label-free immunoassay for specific detection of porcine circovirus type 2 (PCV2), which is a minim animal virus. Staphylococcal protein A (SPA) was used to modify the silanized fiber surface thus forming a SPA layer, which would greatly enhance the proportion of anti-PCV2 monoclonal antibody (MAb) bioactivity, thus improving the effectiveness of specific adsorption and binding events between anti-PCV2 MAbs and PCV2 antigens. Immunoassay experiments were carried out by monitoring the resonance wavelength shift of the proposed sensor under different PCV2 titer levels. Anti-PCV2 MAbs were thoroughly dissociated from the SPA layer by treatment with urea, and recombined to the SPA layer on the sensor surface for repeated immunoassay of PCV2. The specificity of the immunosensor was inspected by detecting porcine reproductive and respiratory syndrome virus (PRRSV) first, and PCV2 subsequently. The results showed a limit of detection (LOD) for the PCV2 immunosensor of ~9.371TCID50/mL, for a saturation value of ~4.801×103TCID50/mL, with good repeatability and excellent specificity.

Anticorpos anti-trypanosoma cruzi como preditivos de infecção por leishmania infantum

Leishmania infantum and Trypanosoma cruzi are trypanosomatids of medical importance and are, respectively, the etiologic agents of visceral leishmaniasis (VL) and Chagas disease (CD) in Brazil. People infected with L. infantum or T. cruzi may develop asymptomatically, enabling the transmission of pathogens through blood transfusion and / or organs. The assessment of the infection by T. cruzi is included among the tests performed for screening blood donors in Brazil, however, there is no availability of tests for Leishmania. Serological tests for T. cruzi are very sensitive, but not specific, and may have cross-reactions with other microorganisms. Thus, the aim of this study was to determine the prevalence of Leishmania infection in blood donors and assess whether the serological test for T. cruzi detect L. infantum. Among the 300 blood samples from donors, discarded in 2011, 61 were T. cruzi positive, 203 were from donors with other infections and 36 were from handbags with low blood volume, but without infection. We also assessed 144 samples from donors without infections and able to donate blood, totaling 444 subjects. DNA was extracted from blood samples of all to perform quantitative PCR (qPCR) to detect Leishmania DNA. The buffy coat obtained from all samples was grown in Schneider medium supplemented and NNN. All samples were evaluated for the presence of anti-Leishmania antibody. The serological results indicate a percentage of 22% of Leishmania infection in blood samples obtained from discarded bags. A total of 60% of samples positive in ELISA for T. cruzi were negative by IFI, used as confirmatory test, ie 60% false positive for Chagas. Among these samples false positive for Chagas, 72% were positive by ELISA for Leishmania characterizing the occurrence of cross reaction between serologic assays. Of the 300 cultures performed, 18 grew parasites that were typed by qPCR and specific isoenzymes, found the species Leishmania infantum crops. Among the 18 cultures, 4 were purged from scholarships for low volume and all negative serology blood bank, thus demonstrating that there is a real risk of Leishmania transmission via transfusion. It is concluded that in an area endemic for leishmaniasis in Brazil, serological diagnosis performed to detect infection by T. cruzi among blood donors can identify infection by L. infantum and although cause false positive for Chagas, this cross-reactivity reduces the risk of Leishmania infection via blood transfusion, since tests are not applied specific detection of the parasite. In this way, there remains the need to discuss the implementation of a specific serological screening test for Leishmania in endemic countries such as Brazil

Evaluación del desempeño de pruebas diagnósticas de tuberculosis en pacientes VIH positivo en dos hospitales públicos de Bogotá

La tuberculosis TB es una de las principales causas de muerte en el mundo en individuos con infección por VIH. En Colombia esta coinfección soporta una carga importante en la población general convirtiéndose en un problema de salud pública. En estos pacientes las pruebas diagnósticas tienen sensibilidad inferior y la enfermedad evoluciona con mayor frecuencia hacia formas diseminadas y rápidamente progresivas y su diagnóstico oportuno representa un reto en Salud. El objetivo de este proyecto es evaluar el desempeño de las pruebas diagnósticas convencionales y moleculares, para la detección de TB latente y activa pacientes con VIH, en dos hospitales públicos de Bogotá. Para TB latente se evaluó la concordancia entre las pruebas QuantiFERON-TB (QTF) y Tuberculina (PPD), sugiriendo superioridad del QTF sobre la PPD. Se evaluaron tres pruebas diagnósticas por su sensibilidad y especificidad, baciloscopia (BK), GenoType®MTBDR plus (Genotype) y PCR IS6110 teniendo como estándar de oro el cultivo. Los resultados de sensibilidad (S) y especificidad (E) de cada prueba con una prevalencia del 19,4 % de TB pulmonar y extrapulmonar en los pacientes que participaron del estudio fue: BK S: 64% E: 99,1%; Genotype S: 77,8% E: 94,5%; PCRIS6110 S: 73% E: 95,5%, de la misma forma se determinaron los valores predictivos positivos y negativos (VPP y VPN) BK: 88,9% y 94,8%, Genotype S: 77,8% E: 94,5%; PCRIS6110 S: 90% y 95,7%. Se concluyó bajo análisis de curva ROC que las pruebas muestran un rendimiento diagnóstico similar por separado en el diagnóstico de TB en pacientes con VIH, aumentando su rendimiento diagnostico cuando se combinan

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Evaluation of a recombinant p24 antigen for the detection of Feline Immunodeficiency Virus-specific antibodies

Feline Immunodeficiency Virus is a worldwide infection and is considered a significant pathogen. The diagnosis of FIV infections is mainly based on commercially available rapid tests that are highly expensive in Brazil, hence it is rarely performed in the country. Furthermore, lentiviruses grow slowly and poorly in tissue cultures, making the production of viral antigen by classic means and thus the establishment of FIV immunodiagnosis impracticable. In order to deal with this, recombinant DNA techniques were adopted to produce the protein p24, a viral capsid antigen. The protein's reactivity evaluation analyzed by Western blot indicated that this recombinant antigen can be a useful tool for the immunodiagnostic of FIV infections.

Sequence-specific electrochemical detection of Alicyclobacillus acidoterrestris DNA using electroconductive polymer-modified fluorine tin oxide electrodes

This study outlines the quantification of low levels of Alicyclobacillus acidoterrestris in pure cultures, since this bacterium is not inactivated by pasteurization and may remain in industrialized foods and beverages. Electroconductive polymer-modified fluorine tin oxide (FTO) electrodes and multiple nanoparticle labels were used for biosensing. The detection of A. acidoterrestris in pure cultures was performed by reverse transcription polymerase chain reaction (RT-PCR) and the sensitivity was further increased by asymmetric nested RT-PCR using electrochemical detection for quantification of the amplicon. The quantification of nested RT-PCR products by Ag/Au-based electrochemical detection was able to detect 2 colony forming units per mL (CFU mL(-1)) of spores in pure culture and low detection and quantification limits (7.07 and 23.6 nM, respectively) were obtained for the target A. acidoterrestris on the electrochemical detection bioassay.

Human cryptosporidiosis: detection of specific antibodies in the serum by an indirect immunofluorescence

Cryptosporidium sp., a coccidian parasite usually found in the faeces of cattle, has been recently implicated as an agent of human intestinal disease, mainly in immunocompromised patients. In the study realized, by an indirect immunofluorescence technique, specific immunoglobulins (IgG and IgM) have been demonstrated in human serum against Cryptosporidium oocysts. Purified oocysts were used as antigens in the indirect immunofluorecence assay. After analyzing this test in sera from selected groups of patients, the frequency of both specific IgG and IgM of immunocompetent children who were excreting oocysts in their faeces was 62% and in children with negative excretion of oocysts was 20% and 40%, respectively. In adults infected with the human immunodeficiency virus (HIV) and who were excreting Cryptosporidium in their stools, the frequency was 57% for IgG but only 2% for IgM. Twenty three percent of immunocompromised adults with not determined excretion of oocysts in their stools had anti-Cryptosporidium IgG in their sera. Children infected with human immunodeficiency virus had no IgM and only 14% had IgG detectable in their sera. The indirect immunoflorescence assay, when used with other parasitological techniques appears to be useful for retrospective population studies and for diagnosis of acute infection. The humoral immune response of HIV positive patients to this protozoan agent needs clarification.

Oriented Tailoring of Plastic Antibodies for Prostate Specific Antigen and Application of the Imprinted Material as Ionophore in Potentiometric Detection

Prostate Specific Antigen (PSA) is the biomarker of choice for screening prostate cancer throughout the population, with PSA values above 10 ng/mL pointing out a high probability of associated cancer1. According to the most recent World Health Organization (WHO) data, prostate cancer is the commonest form of cancer in men in Europe2. Early detection of prostate cancer is thus very important and is currently made by screening PSA in men over 45 years old, combined with other alterations in serum and urine parameters. PSA is a glycoprotein with a molecular mass of approximately 32 kDa consisting of one polypeptide chain, which is produced by the secretory epithelium of human prostate. Currently, the standard methods available for PSA screening are immunoassays like Enzyme-Linked Immunoabsorbent Assay (ELISA). These methods are highly sensitive and specific for the detection of PSA, but they require expensive laboratory facilities and high qualify personal resources. Other highly sensitive and specific methods for the detection of PSA have also become available and are in its majority immunobiosensors1,3-5, relying on antibodies. Less expensive methods producing quicker responses are thus needed, which may be achieved by synthesizing artificial antibodies by means of molecular imprinting techniques. These should also be coupled to simple and low cost devices, such as those of the potentiometric kind, one approach that has been proven successful6. Potentiometric sensors offer the advantage of selectivity and portability for use in point-of-care and have been widely recognized as potential analytical tools in this field. The inherent method is simple, precise, accurate and inexpensive regarding reagent consumption and equipment involved. Thus, this work proposes a new plastic antibody for PSA, designed over the surface of graphene layers extracted from graphite. Charged monomers were used to enable an oriented tailoring of the PSA rebinding sites. Uncharged monomers were used as control. These materials were used as ionophores in conventional solid-contact graphite electrodes. The obtained results showed that the imprinted materials displayed a selective response to PSA. The electrodes with charged monomers showed a more stable and sensitive response, with an average slope of -44.2 mV/decade and a detection limit of 5.8X10-11 mol/L (2 ng/mL). The corresponding non-imprinted sensors showed smaller sensitivity, with average slopes of -24.8 mV/decade. The best sensors were successfully applied to the analysis of serum samples, with percentage recoveries of 106.5% and relatives errors of 6.5%.

Specific label-free and real-time detection of oxidized low density lipoprotein (oxLDL) using an immunosensor with three monoclonal antibodies

Increased levels of plasma oxLDL, which is the oxidized fraction of Low Density Lipoprotein (LDL), are associated with atherosclerosis, an inflammatory disease, and the subsequent development of severe cardiovascular diseases that are today a major cause of death in modern countries. It is therefore important to find a reliable and fast assay to determine oxLDL in serum. A new immunosensor employing three monoclonal antibodies (mAbs) against oxLDL is proposed in this work as a quick and effective way to monitor oxLDL. The oxLDL was first employed to produce anti-oxLDL monoclonal antibodies by hybridoma cells that were previously obtained. The immunosensor was set-up by selfassembling cysteamine (Cyst) on a gold (Au) layer (4 mm diameter) of a disposable screen-printed electrode. Three mAbs were allowed to react with N-hydroxysuccinimide (NHS) and ethyl(dimethylaminopropyl)carbodiimide (EDAC), and subsequently incubated in the Au/Cys. Albumin from bovine serum (BSA) was immobilized further to ensure that other molecules apart from oxLDL could not bind to the electrode surface. All steps were followed by various characterization techniques such as electrochemical impedance spectroscopy (EIS) and square wave voltammetry (SWV). The analytical operation of the immunosensor was obtained by incubating the sensing layer of the device in oxLDL for 15 minutes, prior to EIS and SWV. This was done by using standard oxLDL solutions prepared in foetal calf serum, in order to simulate patient's plasma with circulating oxLDL. A sensitive response was observed from 0.5 to 18.0 mg mL 1 . The device was successfully applied to determine the oxLDL fraction in real serum, without prior dilution or necessary chemical treatment. The use of multiple monoclonal antibodies on a biosensing platform seemed to be a successful approach to produce a specific response towards a complex multi-analyte target, correlating well with the level of oxLDL within atherosclerosis disease, in a simple, fast and cheap way.