The effect of sample and sample matrix on DNA processing: Mechanisms for the detection and management of inhibition in forensic samples

The presence of inhibitory substances in biological forensic samples has, and continues to affect the quality of the data generated following DNA typing processes. Although the chemistries used during the procedures have been enhanced to mitigate the effects of these deleterious compounds, some challenges remain. Inhibitors can be components of the samples, the substrate where samples were deposited or chemical(s) associated to the DNA purification step. Therefore, a thorough understanding of the extraction processes and their ability to handle the various types of inhibitory substances can help define the best analytical processing for any given sample. A series of experiments were conducted to establish the inhibition tolerance of quantification and amplification kits using common inhibitory substances in order to determine if current laboratory practices are optimal for identifying potential problems associated with inhibition. DART mass spectrometry was used to determine the amount of inhibitor carryover after sample purification, its correlation to the initial inhibitor input in the sample and the overall effect in the results. Finally, a novel alternative at gathering investigative leads from samples that would otherwise be ineffective for DNA typing due to the large amounts of inhibitory substances and/or environmental degradation was tested. This included generating data associated with microbial peak signatures to identify locations of clandestine human graves. Results demonstrate that the current methods for assessing inhibition are not necessarily accurate, as samples that appear inhibited in the quantification process can yield full DNA profiles, while those that do not indicate inhibition may suffer from lowered amplification efficiency or PCR artifacts. The extraction methods tested were able to remove >90% of the inhibitors from all samples with the exception of phenol, which was present in variable amounts whenever the organic extraction approach was utilized. Although the results attained suggested that most inhibitors produce minimal effect on downstream applications, analysts should practice caution when selecting the best extraction method for particular samples, as casework DNA samples are often present in small quantities and can contain an overwhelming amount of inhibitory substances.^

Analysis and detection of partial discharges in an electric motor of a hybrid supercar.

The objective of this thesis was the development of a new detection method of partial discharge (PD) activity in the stator of an electrical hybrid supercar fed by a silicon carbide converter, for which detection with common methods make it very difficult to separate PD pulses from switching noise. This work focused on the analysis and detection of partial discharges making use of an antenna, a peak detector, and an oscilloscope capable of capturing the electromagnetic pulses emitted during PD activity. Validation of the proposed method was done by comparing the partial discharge inception voltage (PDIV) detected by this system with the one obtained from an optical method of proven accuracy, with different rise times and samples. Further development of this method, if proved successful on a full stator, can help increasing the overall reliability of the car, potentially allowing for real time detection of PD activity and predictive maintenance before failure of the insulation system in a hybrid vehicle.

Non-invasive detection of acute cell-mediated graft rejection in paediatric heart transplant recipients: the role of cardiovascular magnetic resonance

Background and Aim: Acute cardiac rejection is currently diagnosed by endomyocardial biopsy (EMB), but multiparametric cardiac magnetic resonance (CMR) may be a non-invasive alternative by its capacity for myocardial structure and function characterization. Our primary aim was to determine the utility of multiparametric CMR in identifying acute graft rejection in paediatric heart transplant recipients. The second aim was to compare textural features of parametric maps in cases of rejection versus those without rejection. Methods: Fifteen patients were prospectively enrolled for contrast-enhanced CMR followed by EMB and right heart catheterization. Images were acquired on a 1,5 Tesla scanner including T1 mapping (modified Look-Locker inversion recovery sequence – MOLLI) and T2 mapping (modified GraSE sequence). The extracellular volume (ECV) was calculated using pre- and post-gadolinium T1 times of blood and myocardium and the patient’s hematocrit. Markers of graft dysfunction including hemodynamic measurements from echocardiography, catheterization and CMR were collated. Patients were divided into two groups based on degree of rejection at EMB: no rejection with no change in treatment (Group A) and acute rejection requiring new therapy (Group B). Statistical analysis included student’t t test and Pearson correlation. Results: Acute rejection was diagnosed in five patients. Mean T1 values were significantly associated with acute rejection. A monotonic, increasing trend was noted in both mean and peak T1 values, with increasing degree of rejection. ECV was significantly higher in Group B. There was no difference in T2 signal between two groups. Conclusion: Multiparametric CMR serves as a noninvasive screening tool during surveillance encounters and may be used to identify those patients that may be at higher risk of rejection and therefore require further evaluation. Future and multicenter studies are necessary to confirm these results and explore whether multiparametric CMR can decrease the number of surveillance EMBs in paediatric heart transplant recipients.

Construction and detectors’ characterization of a new detection system for FAMU Experiment

From 2010, the Proton Radius has become one of the most interest value to determine. The first proof of not complete understanding of its internal structure was the measurement of the Lamb Shift using the muonic hydrogen, leading to a value 7σ lower. A new road so was open and the Proton Radius Puzzle epoch begun. FAMU Experiment is a project that tries to give an answer to this Puzzle implementing high precision experimental apparatus. The work of this thesis is based on the study, construction and first characterization of a new detection system. Thanks to the previous experiments and simulations, this apparatus is composed by 17 detectors positioned on a semicircular crown with the related electronic circuit. The detectors' characterization is based on the use of a LabView program controlling a digital potentiometer and on other two analog potentiometers, all three used to set the amplitude of each detector to a predefined value, around 1.2 V, set on the oscilloscope by which is possible to observe the signal. This is the requirement in order to have, in the final measurement, a single high peak given by the sum of all the signals coming from the detectors. Each signal has been acquired for almost half of an hour, but the entire circuit has been maintained active for more time to observe its capacity to work for longer periods. The principal results of this thesis are given by the spectra of 12 detectors and the corresponding values of Voltages, FWHM and Resolution. The outcomes of the acquisitions show also another expected behavior: the strong dependence of the detectors from the temperature, demonstrating that an its change causes fluctuations in the signal. In turn, these fluctuations will affect the spectrum, resulting in a shifting of the curve and a lower Resolution. On the other hand, a measurement performed in stable conditions will lead to accordance between the nominal and experimental measurements, as for the detectors 10, 11 and 12 of our system.

A Highly Improved Method For Sensitive Determination Of Amitriptyline In Pharmaceutical Formulations Using An Unmodified Carbon Nanotube Electrode In The Presence Of Sulfuric Acid.

The present paper describes a novel, simple and reliable differential pulse voltammetric method for determining amitriptyline (AMT) in pharmaceutical formulations. It has been described for many authors that this antidepressant is electrochemically inactive at carbon electrodes. However, the procedure proposed herein consisted in electrochemically oxidizing AMT at an unmodified carbon nanotube paste electrode in the presence of 0.1 mol L(-1) sulfuric acid used as electrolyte. At such concentration, the acid facilitated the AMT electroxidation through one-electron transfer at 1.33 V vs. Ag/AgCl, as observed by the augmentation of peak current. Concerning optimized conditions (modulation time 5 ms, scan rate 90 mV s(-1), and pulse amplitude 120 mV) a linear calibration curve was constructed in the range of 0.0-30.0 μmol L(-1), with a correlation coefficient of 0.9991 and a limit of detection of 1.61 μmol L(-1). The procedure was successfully validated for intra- and inter-day precision and accuracy. Moreover, its feasibility was assessed through analysis of commercial pharmaceutical formulations and it has been compared to the UV-vis spectrophotometric method used as standard analytical technique recommended by the Brazilian Pharmacopoeia.

Assessment Of Robustness On Analysis Using Headspace Solid-phase Microextraction And Comprehensive Two-dimensional Gas Chromatography Through Experimental Designs.

Plackett-Burman experimental design was applied for the robustness assessment of GC×GC-qMS (Comprehensive Two-Dimensional Gas Chromatography with Fast Quadrupolar Mass Spectrometric Detection) in quantitative and qualitative analysis of volatiles compounds from chocolate samples isolated by headspace solid-phase microextraction (HS-SPME). The influence of small changes around the nominal level of six factors deemed as important on peak areas (carrier gas flow rate, modulation period, temperature of ionic source, MS photomultiplier power, injector temperature and interface temperature) and of four factors considered as potentially influential on spectral quality (minimum and maximum limits of the scanned mass ranges, ions source temperature and photomultiplier power). The analytes selected for the study were 2,3,5-trimethylpyrazine, 2-octanone, octanal, 2-pentyl-furan, 2,3,5,6-tetramethylpyrazine, and 2-nonanone e nonanal. The factors pointed out as important on the robustness of the system were photomultiplier power for quantitative analysis and lower limit of mass scanning range for qualitative analysis.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A Rapid And Simple Capillary Electrophoresis Method For Indirect Determination Of The Biocide 2,2-dibromo-3-nitrilo-propionamide (dbnpa) In Cooling Waters.

A capillary zone electrophoresis (CE) method was developed for the determination of the biocide 2,2-dibromo-3-nitrilo-propionamide (DBNPA) in water used in cooling systems. The biocide is indirectly determined by CE measurement of the concentration of bromide ions produced by the reaction between the DBNPA and bisulfite. The relationship between the bromide peak areas and the DBNPA concentrations showed a good linearity and a coefficient of determination (R(2)) of 0.9997 in the evaluated concentration range of 0-75 μmol L(-1). The detection and quantification limits for DBNPA were 0.23 and 0.75 μmol L(-1), respectively. The proposed CE method was successfully applied for the analysis of samples of tap water and cooling water spiked with DBNPA. The intra-day and inter-day (intermediary) precisions were lower than 2.8 and 6.2%, respectively. The DBNPA concentrations measured by the CE method were compared to the values obtained by a spectrophotometric method and were found to agree well.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Efeito das sessões de familiarização sobre o pico de torque e taxa de desenvolvimento de torque : comparações entre jovens, meia idade e idosos = Effect of familiarization sessions on peak torque and rate of torque development : comparisons among young, middle age and elderly

Universidade Estadual de Campinas, Faculdade de Educação Física

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.