Gardening for Health: Patterns of Gardening and Fruit and Vegetable Consumption on the Navajo Nation

Thesis (Master's)--University of Washington, 2016-08

Comparison of firmness meters for measuring ‘Hass’ avocado fruit firmness

The temporal passage of fruit through the supply chain and the selection of consumable fruit by shoppers depend primarily upon fruit firmness. Traditionally, fruit firmness measuring methods, like Effegi and conical probes, are relatively inefficient and destructive. Simple, accurate and non-damaging methods of measuring fruit firmness are ideally required to help assure eating quality to the consumer without fruit wastage. The firmness of 'Hass' avocado fruit at a range of ripening stages was measured with the various different firmness measuring techniques of the Sinclair iQ Firmness Tester (SIQFT), the Electronic Firmometer (EF), the Analogue Firmness Meter (AFM) and hand squeezing. Measurements were made by each method at different points on the same fruit. Destructive bruise assessment was performed 48 h later, thereby allowing sufficient time for fruit to express any bruising resulting from the act of firmness measurements. Non-linear relationships were determined between fruit firmness values measured with the different techniques. The adjusted R2 for the relationship between the SIQFT and the EF was 91.6%. For the SIQFT and the AFM, the adjusted R2 was 73.7%. It was 77.7% for the SIQFT and hand squeezing. A significantly (P<0.05) high incidence of bruising was associated with firmness assessment by the EF as compared with either the SIQFT or the AFM. Among the methods compared, the SIQFT was non-damaging compared with the EF and relatively efficient for measuring the firmness. This instrument merits consideration as a quality control tool of choice in 'Hass' avocado supply chains.

Jujube fruit water relations during fruit maturation stage under different water deficit conditions

The fruit maturation stage is considered the optimal phenological stage for implementing water deficitin jujube (Zizyphus jujuba Mill.), since a low, moderate or severe water deficit at this time has no effect onyield, fruit volume or eating quality. However, no information exists at fruit water relations level on themechanisms developed by Z. jujuba to confront drought. The purpose of the present study was to increaseour understanding of the relationship between leaf and fruit water relations of jujube plants under dif-ferent irrigation conditions during fruit maturation, paying special attention to analysing whether fruitsize depends on fruit turgor. For this, adult jujube trees (cv. Grande de Albatera) were subjected to fiveirrigation treatments. Control plants (T0) were irrigated daily above their crop water requirements inorder to attain non-limiting soil water conditions in 2012 and 2013. T1 plants were subjected to deficitirrigation throughout the 2012 season, according to the criteria frequently used by the growers in thearea. T2 (2012), T3 and T4 (2013) were irrigated as T0 except during fruit maturation, in which irrigationwas withheld for 32, 17 and 24 days, respectively. The results indicated that the jujube fruit maturationperiod was clearly sensitive to water deficit. During most of this stage water could enter the fruits viathe phloem rather than via the xylem. From the beginning of water withholding to when maximumwater stress levels were achieved, fruit and leaf turgor were maintained in plants under water deficit.However, a direct relation between turgor and fruit size was not found in jujube fruits, which could bedue to an enhancement of a cell elasticity mechanism (elastic adjustment) which maintains fruit turgorby reducing fruit cells size or to the fact that jujube fruit growth depends on the fruit growth-effectiveturgor rather than just turgor pressure.

Molecular And Biochemical Characterization Of Caffeine Synthase And Purine Alkaloid Concentration In Guarana Fruit.

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Molecular Genetic Variability Of Commercial And Wild Accessions Of Passion Fruit (passiflora Spp.) Targeting Ex Situ Conservation And Breeding.

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Phylogenetic And Phylogeographic Mapping Of The Avian Coronavirus Spike Protein-encoding Gene In Wild And Synanthropic Birds.

The evolution and population dynamics of avian coronaviruses (AvCoVs) remain underexplored. In the present study, in-depth phylogenetic and Bayesian phylogeographic studies were conducted to investigate the evolutionary dynamics of AvCoVs detected in wild and synanthropic birds. A total of 500 samples, including tracheal and cloacal swabs collected from 312 wild birds belonging to 42 species, were analysed using molecular assays. A total of 65 samples (13%) from 22 bird species were positive for AvCoV. Molecular evolution analyses revealed that the sequences from samples collected in Brazil did not cluster with any of the AvCoV S1 gene sequences deposited in the GenBank database. Bayesian framework analysis estimated an AvCoV strain from Sweden (1999) as the most recent common ancestor of the AvCoVs detected in this study. Furthermore, the analysis inferred an increase in the AvCoV dynamic demographic population in different wild and synanthropic bird species, suggesting that birds may be potential new hosts responsible for spreading this virus.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Malpighiaceae: correlations between habit, fruit type and basic chromosome number

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Dynamic and steady: shear rheological properties of xanthan and guar gums dispersed in yellow passion fruit pulp (Passiflora edulis f. flavicarpa)

Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.

Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae) fruit-fly species and their hybrids

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Birds from cerradão woodland, an overlooked forest of the Cerrado region, Brazil

The Cerrado region still receives relatively little ornithological attention, although it is regarded as the only tropical savanna in the world considered to be a biodiversity hotspot. Cerradão is one of the least known and most deforested Cerrado physiognomies and few recent bird surveys have been conducted in these forests. In order to rescue bird records and complement the few existing inventories of this under-studied forest type in the state of São Paulo, we looked for published papers on birds of cerradão. Additionally we surveyed birds at a 314-ha cerradão remnant located in central São Paulo, Brazil, from September 2005-December 2006 using unlimited distance transect counts. Out of 95 investigations involving cerradão bird studies, only 17 (18%) investigations teased apart bird species recorded inside cerradão from those recorded in other physiognomies of Cerrado. Except for one study, no research found more than 64 species in this type of forest, a result shared within many regions from Brazil and Bolivia. Differences in species richness do not seem be related with levels of disturbance of landscape or fragment size. Considering all species recorded in cerradão in Brazil and Bolivia, a compilation of data accumulated 250 species in 36 families and 15 orders. In recent surveys at central São Paulo, we recorded 48 species in 20 families, including the Pale-bellied Tyrant-Manakin Neopelma pallescens, threatened in São Paulo, and the Helmeted Manakin Antilophia galeata, near threatened in the state and endemic to the Cerrado region. Among the most abundant species inside this fragment, none was considered to be neither threatened nor endemic.

Stability of fruit bases and chocolate fillings

Syrups with high sugar content and dehydrated fruits in its composition can be added to chocolate fillings to reduce the need of artificial flavor and dyes attributing a natural appeal to the product. Fruit bases were produced with lyophilized strawberry, passion fruit, and sliced orange peel. Rheological dynamic oscillatory tests were applied to determine the products stability and tendency of shelf life. Values of G´< G´´ were observed for strawberry and passion fruit flavor, whereas values of G´ > G´´ were found for orange flavor during the 90 days of storage. It was observed that shear stress values did not vary significantly suggesting product stability during the studied period. For all fillings, it was found a behavior similar to the fruit base indicating that it has great influence on the filling behavior and its stability. The use of a sugar matrix in fillings provided good shelf life for the fruit base, which could be kept under room temperature conditions for a period as long as one year. The good stability and storage conditions allow the use of fruit base for handmade products as well as for industrialized products.

Fatores associados à qualidade da dieta de adultos residentes na Região Metropolitana de São Paulo, Brasil, 2002

Objetivou-se avaliar os fatores demográficos, sócio-econômicos e de estilo de vida associados à qualidade da dieta de adultos residentes na Região Metropolitana de São Paulo, Brasil. Estudo transversal, por meio de inquérito domiciliar, de base populacional, foi realizado no Distrito do Butantã e nos municípios de Itapecerica da Serra, Embu e Taboão da Serra. Utilizaram-se dados de um questionário e um recordatório de 24 horas de 1.840 adultos de 20 anos ou mais, de ambos os sexos, incluídos em um inquérito de saúde (ISA-SP). A qualidade da dieta foi avaliada através do índice de qualidade da dieta (IQD) adaptado para a realidade local. Utilizou-se análise de regressão linear para avaliar a associação entre o IQD e as demais variáveis. A maioria da população (75%) apresentou dieta que necessita de melhora. Observaram-se médias baixas para os componentes: frutas, verduras e legumes, leite e derivados. Número de bens de consumo duráveis, escolaridade do chefe da família e ter 60 anos ou mais se associaram ao IQD em homens. Para as mulheres, a faixa etária se associou ao IQD. Em ambos os modelos, o consumo de calorias se manteve como variável de ajuste.

Effects of an intervention in eating habits and physical activity in Japanese-Brazilian women with a high prevalence of metabolic syndrome in Bauru, São Paulo State, Brazil

We evaluated the impact of a lifestyle intervention on the cardiometabolic risk profile of women participating in the Study on Diabetes and Associated Diseases in the Japanese-Brazilian Population in Bauru. This was a non-controlled experimental study including clinical and laboratory values at baseline and after a 1-year intervention period. 401 Japanese-Brazilian women were examined (age 60.8±11.7 years), and 365 classified for metabolic syndrome (prevalence = 50.6%). Subjects with metabolic syndrome were older than those without (63.0±10.0 vs. 56.7±11.6 years, p < 0.01). After intervention, improvements in variables were found, except for C-reactive protein. Body mass index and waist circumference decreased, but adiposity reduction was more pronounced in the abdominal region (87.0±9.7 to 84.5±11.2cm, p < 0.001). Intervention-induced differences in total cholesterol, LDL, and post-challenge glucose were significant; women who lost more than 5% body weight showed a better profile than those who did not. The lifestyle intervention in Japanese-Brazilian women at high cardiometabolic risk improved anthropometric and laboratory parameters, but it is not known whether such benefits will persist and result in long-term reduction in cardiovascular events.