262 resultados para Folate
Resumo:
OBJETIVO: Avaliar a ingestão alimentar de micronutrientes em pré-escolares no domicílio e em escolas de educação infantil públicas e particulares. MÉTODOS: Estudo transversal realizado com 362 pré-escolares entre dois e seis anos de idade, em Caxias do Sul (RS) Brasil, em 2007. A ingestão alimentar na escola foi avaliada por meio do método de pesagem direta individual, e no domicílio, por meio de registro alimentar realizado pelos pais ou responsáveis. Foi calculada a ingestão alimentar de cálcio, ferro, folato, vitamina A, vitamina C e zinco de acordo com o local da refeição e tipo de escola. RESULTADOS: Houve maior ingestão de alimentos contendo ferro, folato e vitamina C durante o período em que as crianças permaneceram na escola infantil, e maior ingestão de cálcio, vitamina A e zinco no domicílio. Houve significativamente maior ingestão de alimentos contendo ferro (p=0,03), folato (p=0,03), vitamina A (p<0,01) e vitamina C (p<0,01) pelas crianças da escola particular e maior ingestão de cálcio (p<0,01) e zinco (p<0,01) na escola pública. Quanto à prevalência de inadequação dos micronutrientes, as crianças não apresentaram risco deficiente para ingestão de ferro, folato, vitamina A e C e zinco, porém apenas 67,4% apresentaram ingestão de cálcio igual ou acima ao valor de referência. CONCLUSÃO: Os achados sugerem que o consumo de cálcio, vitamina A e zinco foi maior nos domicílios, apesar de as crianças permanecerem a maior parte do dia nas escolas. O consumo diário de micronutrientes de crianças de escolas públicas e particulares não diferiu significativamente, mesmo com diferenças nos cardápios.
Resumo:
OBJETIVO: Avaliar a adequação da ingestão de energia, macro e micronutrientes em adolescentes modelos de passarela. MÉTODOS: Estudo transversal de 33 adolescentes modelos e 33 não modelos, de 15 a 18 anos, pareadas por idade e índice de massa corpórea (IMC). A ingestão alimentar foi avaliada por meio de registro alimentar de três dias, sendo calculados os valores médios de energia, em kcal, os valores proporcionais dos macronutrientes em relação ao valor calórico total da dieta consumida, bem como os valores médios/medianos dos seguintes micronutrientes: cálcio, ferro, zinco, fósforo, magnésio, folato, vitamina D, vitamina C, vitamina A e vitamina E. RESULTADOS: Verificou-se que 24% das adolescentes do estudo apresentaram IMC abaixo dos valores mínimos para a idade. A média de ingestão de energia foi menor entre as modelos, em comparação às adolescentes não modelos (1.480,93±582,95 versus 1.973,00±557,63 kcal) (p<0,05). A ingestão de gorduras acima do recomendado foi semelhante entre os grupos - 30,3% das adolescentes modelos e 36,4% das adolescentes não modelos (p>0,05). O consumo inadequado de micronutrientes como o cálcio, ferro, zinco, magnésio, fósforo, vitaminas lipossolúveis, folato e ácido ascórbico ocorreu em ambos os grupos. CONCLUSÕES: A baixa ingestão energética (kcal) entre as modelos e a ingestão insuficiente de minerais e vitaminas alertam para que as agências de modelos comprometam-se com a saúde dessas adolescentes, garantindo um acompanhamento médico e nutricional.
Resumo:
OBJETIVO: Investigar os níveis séricos e a prevalência de inadequação da ingestão dietética de folato e das vitaminas B6 e B12, identificando os alimentos contribuintes para a ingestão desses nutrientes. MÉTODOS: Estudo observacional, transversal, em adolescentes de 16 a 19 anos, de ambos os sexos, conduzido em Indaiatuba (SP). Coletou-se o registro alimentar de 3 dias não consecutivos. A dieta habitual foi estimada pela remoção da variabilidade intrapessoal, e a prevalência de inadequação da ingestão, pelo método da estimated average requirement como ponto de corte. As análises bioquímicas de folato, B6 e B12 foram conduzidas de acordo com os métodos aceitos na literatura. RESULTADOS: O estudo foi conduzido com 99 adolescentes, a maioria do sexo feminino (58,6%), com média de idade de 17,6 (desvio padrão, DP 0,9) anos. As médias da concentração sérica de folato, B6 e B12 foram de 9,2 (DP 3,4) ng/mL, 18,7 (DP 5,1) nmol/L e 397,5 (DP 188,4) pg/mL, respectivamente; e a prevalência de inadequação da ingestão das vitaminas foi de 15,2, 10,2 e < 1%, respectivamente. Os alimentos que mais contribuíram para a ingestão dos nutrientes foram, para folato: pão francês, macarrão e feijões; para B6: arroz branco, carne de frango e carne bovina; e para B12: carne bovina magra, leite integral e carne bovina gorda. CONCLUSÕES: As prevalências de inadequação de folato, B6 e B12 mostraram-se baixas, possivelmente em decorrência da melhoria do acesso e da disponibilidade de alimentos, fontes dietéticas das vitaminas. Os feijões, presentes na dieta tradicional brasileira, ainda estão entre os principais alimentos que contribuíram para a ingestão de folato, mesmo após a fortificação mandatória com ácido fólico no Brasil.
Resumo:
O objetivo do presente estudo foi avaliar a prevalência de ingestão inadequada de nutrientes em um grupo de adolescentes de São Bernardo do Campo-SP. Dados de consumo de energia e nutrientes foram obtidos por meio de recordatórios de 24 horas aplicados em 89 adolescentes. A prevalência de inadequação foi calculada utilizando o método EAR como ponto de corte, após ajuste pela variabilidade intrapessoal, utilizando o procedimento desenvolvido pela Iowa State University. As Referências de Ingestão Dietética (IDR) foram os valores de referência para ingestão. Para os nutrientes que não possuem EAR estabelecida, a distribuição do consumo foi comparada com a AI. As maiores prevalências de inadequação em ambos sexos foram observadas para o magnésio (99,3 por cento para o sexo masculino e 81,8 por cento para o feminino), zinco (44,0 por cento para o sexo masculino e 23,5 por cento para o feminino), vitamina C (57,2 por cento para o sexo masculino e 59,9 por cento para o feminino) e folato (34,8 por cento para o sexo feminino). A proporção de indivíduos com ingestão superior à AI foi insignificante (menor que 2,0 por cento) em ambos os sexos
Resumo:
Orthodox teaching and practice on nutrition and health almost always focuses on nutrients, or else on foods and drinks. Thus, diets that are high in folate and in green leafy vegetables are recommended, whereas diets high in saturated fat and in full-fat milk and other dairy products are not recommended. Food guides such as the US Food Guide Pyramid are designed to encourage consumption of healthier foods, by which is usually meant those higher in vitamins, minerals and other nutrients seen as desirable.What is generally overlooked in such approaches, which currently dominate official and other authoritative information and education programmes, and also food and nutrition public health policies, is food processing. It is now generally acknowledged that the current pandemic of obesity and related chronic diseases has as one of its important causes increased consumption of convenience including pre-prepared foods(1,2). However, the issue of food processing is largely ignored or minimised in education and information about food, nutrition and health, and also in public health policies.A short commentary cannot be comprehensive, and a general proposal such as that made here is bound to have some problems and exceptions. Also, the social, cultural, economic and environmental consequences of food processing are not discussed here. Readers comments and queries are invited
Resumo:
Background: Cobalamin (Cbl) and folate deficiencies and gene polymorphism of key enzymes or carriers can impair homocysteine metabolism and may change the serum values of S-adenosylmethionine (SAM) and S-adenosylhomocysteine (SAH). We investigated the nutritional and genetic determinants for total homocysteine (tHcy), methylmalonic acid (MMA) and SAM/SAH in healthy Brazilian childbearing-age women. Methods: Serum concentrations of Cbl, folate, red blood cell folate, ferritin, tHcy, MMA, SAM, SAH and other metabolites were measured in 102 healthy unrelated women. The genotypes for MTHFR C677T, MTHFR A1298C, MTR A2756G, MTRR A66G, TC2 C776G, TC2 A67G and RFCI A80G gene polymorphisms were identified by PCR-RFLP. Results: Serum folate and Cbl were inversely correlated with tHcy and serum MMA, respectively. Cbl deficiency was associated with increased MMA and reduced alpha-aminobutyrate, serine and N-methylglycine concentrations. No variable was associated with SAM/SAH ratio. In addition, gene polymorphisms were not selected as determinants for tHcy, MMA and SAM/SAH ratio. Iron, Cbl and folate deficiencies were found respectively in 30.4%, 22.5% and 2.0% of individuals studied. Conclusions: There was a high frequency of Cbl and iron deficiency in this group of childbearing-age women. Serum folate and Cbl were the determinants of serum tHcy and MMA concentration, respectively. (c) 2007 Elsevier B.V. All rights reserved.
Resumo:
Background: The pathophysiology of spontaneous abortion is complex and may involve the interaction of genetic and environmental factors. We evaluated the predictors of spontaneous abortion in Brazilian pregnant women. The effects of age, gestational age. body mass index (BMI), cigarette smoking, alcohol ingestion, use of multivitamins and concentrations of vitamins (folate, cobalamin and vitamin 136) and vitamin-dependent metabolites were analyzed. Methods: Study population included 100 healthy women that attended pre-natal care in 2 health centers of Sao Paulo, Brazil, and in whom pregnancy outcome was known. Folate and cobalamin status was measured in blood specimens collected between 4 and 16 weeks. The genotypes for 8 gene polymorphisms were evaluated by PCR-RFLP. Results: Eighty-eight women had normal pregnancy outcome (Group 1), while 12 experienced a miscarriage after blood collection (Group 2). Increased methylmalonic acid (MMA) concentrations were found in Group 2 (median [25th-75th percentile]=274 [149-425] nmol/l) relative to Group 1 (138 [98-185]) (P<0.01). No differences between the groups were observed for serum cobalamin, serum or red cell folate, and serum total homocysteine or allele frequencies for 8 polymorphisms. In a conditional logistic regression analysis including age, gestational age, serum creatinine, MMA, cystathionine, body mass index (BMI), cigarette smoking, alcohol ingestion and use of multivitamins the risk of abortion was significantly associated with MMA (OR [95% CI] = 3.80 [1.36, 10.62] per quartile increase in MMA), BMI (OR [95% CI] = 5.49 [1.29,23.39] per quartile) and gestational age (OR [95% CI] = 0.10 [0.01, 0.77] per increase of interval in gestational age). Conclusions: Increased serum MMA and BMI concentrations are associated with spontaneous abortion in Brazilian women. (C) 2009 Elsevier B.V. All rights reserved.
Resumo:
Objectives: To examine the association between methylenetetrahydrofolate reductase (MTHFR) (C677T and A1298C), methionine synthase (MTR) A2756G and methionine synthase reductase (MTRR) A66G gene polymorphisms and total homocysteine (tHcy), methylmalonic acid (MMA) and S-adenosylmethionine/ S-adenosylhomocysteine (SAM/SAH) levels; and to evaluate the potential interactions with folate or cobalamin (Cbl) status. Subjects/ Methods: Two hundred seventy-five healthy women at labor who delivered full-term normal babies. Cbl, folate, tHcy, MMA, SAM and SAH were measured in serum specimens. The genotypes for polymorphisms were determined by PCR-restriction fragment length polymorphism ( RFLP). Results: Serum folate, MTHFR 677T allele and MTR 2756AA genotypes were the predictors of tHcy levels in pregnant women. Serum Cbl and creatinine were the predictors of SAM/SAH ratio and MMA levels, respectively. The gene polymorphisms were not determinants for MMA levels and SAM/SAH ratios. Low levels of serum folate were associated with elevated tHcy in pregnant women, independently of the gene polymorphisms. In pregnant women carrying MTHFR 677T allele, or MTHFR 1298AA or MTRR 66AA genotypes, lower Cbl levels were associated with higher levels of tHcy. Lower SAM/SAH ratio was found in MTHFR 677CC or MTRR A2756AA genotypes carriers when Cbl levels were lower than 142 pmol/l. Conclusions: Serum folate and MTHFR C677T and MTR A2576G gene polymorphisms were the determinants for tHcy levels. The interaction between low levels of serum Cbl and MTHFR (C677T or A1298C) or MTRR A66G gene polymorphisms was associated with increased tHcy.
Resumo:
Methionine is a component of one-carbon metabolism and a precursor of S-adenosylmethionine (SAM), the methyl donor for DNA methylation. When methionine intake is high, an increase of S-adenosylmethionine (SAM) is expected. DNA methyltransferases convert SAM to S-adenosylhomocysteine (SAH). A high intracellular SAH concentration could inhibit the activity of DNA methyltransferases. Therefore, high methionine ingestion could induce DNA damage and change the methylation pattern of tumor suppressor genes. This study investigated the genotoxicity of a methionine-supplemented diet. It also investigated the diet`s effects on glutathione levels, SAM and SAH concentrations and the gene methylation pattern of p53. Wistar rats received either a methionine-supplemented diet (2% methionine) or a control diet (0.3% methionine) for six weeks. The methionine-supplemented diet was neither genotoxic nor antigenotoxic to kidney cells, as assessed by the comet assay. However, the methionine-supplemented diet restored the renal glutathione depletion induced by doxorubicin. This fact may be explained by the transsulfuration pathway, which converts methionine to glutathione in the kidney. Methionine supplementation increased the renal concentration of SAH without changing the SAM/SAH ratio. This unchanged profile was also observed for DNA methylation at the promoter region of the p53 gene. Further studies are necessary to elucidate this diet`s effects on genomic stability and DNA methylation. (C) 2011 Elsevier ay. All rights reserved.
Resumo:
Multiple sclerosis (MS) is a complex neurological disease that affects the central nervous system (CNS) resulting in debilitating neuropathology. Pathogenesis is primarily defined by CNS inflammation and demyelination of nerve axons. Methionine synthase reductase (MTRR) is an enzyme that catalyzes the remethylation of homocysteine (Hcy) to methionine via cobalamin and folate dependant reactions. Cobalamin acts as an intermediate methyl carrier between methylenetetrahydrofolate reductase (MTHFR) and Hcy. MTRR plays a critical role in maintaining cobalamin in an active form and is consequently an important determinant of total plasma Hcy (pHcy) concentrations. Elevated intracellular pHcy levels have been suggested to play a role in CNS dysfunction, neurodegenerative, and cerebrovascular diseases. Our investigation entailed the genotyping of a cohort of 140 cases and matched controls for MTRR and MTHFR, by restriction length polymorphism (RFLP) techniques. Two polymorphisms: MTRR A66G and MTHFR A1298C were investigated in an Australian age and gender matched case-control study. No significant allelic frequency difference was observed between cases and controls at the α = 0.05 level (MTRR χ^2 = 0.005, P = 0.95, MTHFR χ^2 = 1.15, P = 0.28). Our preliminary findings suggest no association between the MTRR A66G and MTHFR A1298C polymorphisms and MS.
Resumo:
A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.
Resumo:
Arylamine N-acetyltransferase-1 (NAT1) is a polymorphically expressed enzyme that is widely distributed throughout the body. In the present study, we provide evidence for substrate-dependent regulation of this enzyme. Human peripheral blood mononuclear cells cultured in medium supplemented with p-aminobenzoic acid (PABA; 6 mu M) for 24 h showed a significant decrease (50-80%) in NAT1 activity. The loss of activity was concentration-dependent (EC50 similar to 2 mu M) and selective because PABA had no effect on the activity of constitutively expressed lactate dehydrogenase or aspartate aminotransferase. PABA also induced down-regulation of NAT1 activity in several human cell lines grown at confluence. Substrate-dependent downregulation was not restricted to PABA. Addition of other NAT1 substrates, such as p-aminosalicylic acid, ethyl-p-aminobenzoate, or p-aminophenol to peripheral blood mononuclear cells in culture also resulted in significant (P < .05) decreases in NAT1 activity. However, addition of the NAT2-selective substrates sulfamethazine, dapsone, or procainamide did not alter NAT1 activity. Western blot analysis using a NAT1-specific antibody showed that the loss of NAT1 activity was associated with a parallel reduction in the amount of NAT1 protein (r(2) = 0.95). Arylamines that did not decrease NAT1 activity did not alter NAT1 protein levels. Semiquantitative reverse transcriptase polymerase chain reaction of mRNA isolated from treated and untreated cells revealed no effect of PABA on NAT1 mRNA levels. We conclude that NAT1 can be down-regulated by arylamines that are themselves NAT1 substrates. Because NAT1 is involved in the detoxification/activation of various drugs and carcinogens, substrate-dependent regulation may have important consequences with regard to drug toxicity and cancer risk.
Resumo:
Arylamine N-acetyltransferase (NAT) was first identified as the inactivator of the anti-tubercular drug isoniazid, The enzyme was shown to catalyse the transfer of an acetyl group from acetyl-CoA to the terminal nitrogen of the hydrazine drug. The rate of inactivation of isoniazid was polymorphically distributed in the population and was one of the first examples of pharmacogenetic variation, NAT was identified recently in Mycobacterium tuberculosis and is a candidate for; modulating the response to isoniazid, Genome sequences have revealed many homologous members of this unique family of enzymes. The first three-dimensional structure of a member of the NAT family identifies a catalytic triad consisting of aspartate, histidine and cysteine proposed to form the activation mechanism. So far, all procaryotic NATs resemble the human enzyme which acetylates isoniazid (NAT2), Human NAT2 is characteristic of drug-metabolizing enzymes: it is found in liver and intestine, In humans and other mammals, there are up to three different isoenzymes. If only one isoenzyme is present, it is like human NAT1. Human NAT1 and its murine equivalent specifically acetylate the folate catabolite p-amino-benzoylglutamate. NAT1 and its murine homologue each have a ubiquitous tissue distribution and are expressed early in development at the blastocyst stage, During murine embryonic development, NAT is expressed in the developing neural tube. The proposed endogenous role of NAT in folate metabolism, and its multi-allelic nature, indicate that its role in development should be assessed further.
Resumo:
Methotrexate is eliminated almost entirely by the kidneys. The risk of methotrexate toxicity is therefore increased in patients with poor renal function, most likely as a result of drug accumulation. Declining renal function with age may thus be an important predictor of toxicity to methotrexate. Up to 60% of all patients who receive methotrexate for rheumatoid arthritis (RA) discontinue taking it because of adverse effects, most of which occur during the first year of therapy. Gastrointestinal complications are the most common adverse effects of methotrexate, but hepatotoxicity, haematological toxicity, pulmonary toxicity, lymphoproliferative disorders and exacerbation of rheumatic nodules have all been reported, Decreased renal function as a result of disease and/or aging appears to be an important determinant of hepatic, lymphoproli ferative and haematological toxicity, Concomitant use of low doses of folic acid has been recommended as an approach to limiting toxicity. Interactions between methotrexate and several nonsteroidal anti-inflammatory drugs have been reported, but they may not be clinically significant. However, caution is advised in the use of such combinations in patients with reduced renal function. More serious toxicities (e.g. pancytopenia) may result when other inhibitors of folate utilisation [e.g. cotrimoxazole (trimethoprim-sulfamethoxazole)] or inhibitors of renal tubular secretion (e.g. probenecid) are combined with methotrexate. Before starting low dose methotrexate therapy in patients with RA, a full blood count, liver function tests, renal function tests and chest radiography should be performed. Blood counts and liver function tests should be repeated at regular intervals. Therapeutic drug monitoring of methotrexate has also been suggested as a means of limiting toxicity. Patients with RA usually respond very favourably to low dose methotrexate therapy, and the probability of patients continuing their treatment beyond 5 years is greater than for other slow-acting antirheumatic drugs. Thus, given its sustained clinical utility and relatively predictable toxicity profile, low dose methotrexate is a useful addition to the therapy of RA.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).