The X-X-/E+E+ genotype of the XbaI/EcoRI polymorphisms of the apolipoprotein B gene as a marker of coronary artery disease in a Brazilian sample

Studies that consider polymorphisms within the apolipoprotein B (apo B) gene as risk factors for coronary artery disease (CAD) have reported conflicting results. The aim of the present study was to search for associations between two DNA RFLPs (XbaI and EcoRI) of the apo B gene and CAD diagnosed by angiography. In the present study we compared 116 Brazilian patients (92 men) with CAD (CAD+) to 78 control patients (26 men) without ischemia or arterial damage (CAD-). The allele frequencies at the XbaI (X) and EcoRI (E) sites did not differ between groups. The genotype distributions of CAD+ and CAD- patients were different (chi²(1) = 6.27, P = 0.012) when assigned to two classes (X-X-/E+E+ and the remaining XbaI/EcoRI genotypes). Multivariate logistic regression analysis showed that individuals with the X-X-/E+E+ genotype presented a 6.1 higher chance of developing CAD than individuals with the other XbaI/EcoRI genotypes, independently of the other risk factors considered (sex, tobacco consumption, total cholesterol, hypertension, and triglycerides). We conclude that the X-X-/E+E genotype may be in linkage disequilibrium with an unknown variation in the apo B gene or with a variation in another gene that affects the risk of CAD.

Absence of hepatitis B virus DNA in patients with hepatitis C and non-A-E hepatitis in the State of São Paulo, Brazil

Occult hepatitis B virus (HBV) infection has been reported as cases in which HBV DNA was detected despite the absence of any HBV serological markers or in cases in which anti-HBc antibody was the sole marker. The aim of the present study was to determine, using the polymerase chain reaction (PCR), whether HBV infection occurs in hepatitis C and non-A-E hepatitis patients without serological evidence of hepatitis B infection in São Paulo State. Two different populations were analyzed: 1) non-A-E hepatitis patients, including 12 patients with acute and 50 patients with chronic hepatic disorders without serological evidence of infection with known hepatitis viruses; 2) 43 patients previously diagnosed as hepatitis C with positive results for anti-HCV and HCV RNA. Among hepatitis C patients, anti-HBc was detected in 18.6% of the subjects. Three different sets of primers were employed for HBV DNA detection by nested PCR, covering different HBV genes: C, S and X. HBV-DNA was not detected in any sample, whereas the positive controls did produce signals. The lack of HBV DNA detection with these pairs of primers could be due to a very low viral load or to the presence of mutations in their annealing sites. The latter is unlikely as these primers were screened against an extensive dataset of HBV sequences. The development of more sensitive methods, such as real time PCR, to detect circular covalent closed DNA is necessary in order to evaluate this question since previous studies have shown that cryptic hepatitis B might occur.

Detection of human cytomegalovirus DNA in various blood components after liver transplantation

The quantification of human cytomegalovirus (HCMV DNA) by real-time PCR is currently a primary option for laboratory diagnosis of HCMV infection. However, the optimal sample material remains controversial due to the use of different PCR assays. To explore the best blood component for HCMV DNA surveillance after liver transplantation, whole blood (WB), serum (SE), and plasma (PL) specimens were collected simultaneously from targeted patients and examined for HCMV DNA using one commercially available assay. The HCMV DNA-positive rate with WB (16.67%) was higher than that with either SE or PL (8.33%, both P<0.01). Quantitative DNA levels in WB were of greater magnitude than those in SE (WB-SE mean log-transformed difference, 0.99; 95%CI=0.74-1.25; P<0.0001) and PL (WB-PL mean log-transformed difference, 1.37; 95%CI=1.07-1.66; P<0.0001). Dynamic monitoring revealed that HCMV DNA in WB was positive sooner and had higher values for a longer period of time during therapy. With earlier positive detection, higher sensitivity, and yield of greater viral loads, WB compared favorably to SE or PL and hence is recommended as the superior material for HCMV DNA surveillance after liver transplantation. In addition, infant recipients require more intensive monitoring and prophylactic care because of their higher susceptibility to primary HCMV infection.

DNA methylation patterns of candidate genes regulated by thymine DNA glycosylase in patients with TP53 germline mutations

Li-Fraumeni syndrome (LFS) is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG) pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17) in 30 patients with germline TP53mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR) with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results.

ESI-MS[n] of anticancer pt[iv] organoamido complexes and their interactions with DNA-model compounds /

The general solution behaviour and" the major fragmentation pathways of the anticanceractive PtIV coordination complexes, trans, trans, cis, cis-[PtCIOH{N(pFC6F4) CH2h(pY)2] (1), trans, cis, cis-[Pt(OH)2{N(p-FC6F4)CH2h(Py)2] (2), trans, cis, cis-[Pt(OH)2{N(p-HC6F4)CH2h(Py)2] (3), trans, trans, cis, cis-[PtCIOH{N(pHC6F4) CH2h(Py)2] (4), and trans, trans, cis, cis-[PtOH(OCH3){N(p-HC6F4)CH2h(PY)2] (5) (Py = pyridine) have been deduced by positive-ion tandem-in-time ESI-MS. Overall, the acquired full-scan, positive-ion ESI-MS spectra of 2, 3, and 5 were characterized by the presence of relatively low-intensity [M+Nar and [M+Kt mass spectral peaks, whereas those of 1 and 4 were dominated by extremely intense [M+Hr peaks. Complexes 2 and 3 were also noted to form [2M+Ht and [2M+Nat dilneric cations. The source of Na + and K+ ions is believed to be the sample, the solvent systems used or the transport line carrying the sample solutions into the ES ion source. Further, the fragmentation pathway of all complexes studied was found to be almost identical with concurrent loss of py and H20 molecules, loss of a {N(p-YC6F4)CH2} (Y = F, H) group and/or concomitant release of the latter group and a py ligand being the most conunon. The photochemical degradation behaviour of 1 and 2 was also investigated using either fluorescent or ultraviolet light and some products of that degradation were positively identified. Altogether, light irradiation of solutions of both complexes resulted in cation cationisation, reductive-elimination, ligand-release, ligand-exchange and ligand-addition reactions. Finally, positive- and negative-ion ESI-MSn spectra of 5' -GMP, guanosine, inosine and products of their reactions with 1, 2,3, and 4 were also recorded. On the whole, full-scan ESI-MS spectra of the pure nucleobases revealed the presence of cationic and anionic species that are highly reflective of both their solution ionic composition and their propensity t9 form polymeric clusters. Analyses of mass spectra acquired from their reaction solutions with the aforementioned platinum complexes indicated very slow kinetics. However, all complexes investigated formed, to various degrees, Pt-nucleobase adducts with guanosine and inosine, but not with 5'-GMP. The products included species having coordination numbers of III, IV, V, and VI, among which the first-time· observed, coordinatively saturated, jive-coordinate PtlI-nucleobase complexes were of most interest. The latter complexes are presumably stabilized by 7tback- donation involving the filled d orbitals of the PtII centre and the empty pz· orbital of MeCN. All products, whose peaks appeared inlull-scan ESI-MS spectra, are believed to represent solution species rather than artifacts of gas-phase processes. Finally, negativeion ESI-MSn spectra recorded in reaction solutions of 1 and 4 with guanosine and of the latter complex with inosine revealed the negative-ion-ESI-MS first-time observed, noncovalent, nucleoside-chloride adducts, with the source of chloride anion being complexes 1 and 4 theillselves. In contrast, no such adducts were observed to form with Na25'-GMP or its protonated fonn. Few suggestions are offered for the possible cause(s) behind the absence of such adduct ions.

Tissue- specific DNA methylation profiles in newborns

Experimental and epidemiological studies demonstrate that fetal growth restriction and low birth weight enhance the risk of chronic diseases in adulthood. Derangements in tissue-specific epigenetic programming of fetal and placental tissues are a suggested mechanism of which DNA methylation is best understood. DNA methylation profiles in human tissue are mostly performed in DNA from white blood cells. The objective of this study was to assess DNA methylation profiles of IGF2 DMR and H19 in DNA derived from four tissues of the newborn. We obtained from 6 newborns DNA from fetal placental tissue (n = 5), umbilical cord CD34+ hematopoietic stem cells (HSC) and CD34- mononuclear cells (MNC) (n = 6), and umbilical cord Wharton jelly (n = 5). HCS were isolated using magnetic-activated cell separation. DNA methylation of the imprinted fetal growth genes IGF2 DMR and H19 was measured in all tissues using quantitative mass spectrometry. ANOVA testing showed tissue-specific differences in DNA methylation of IGF2 DMR (p value 0.002) and H19 (p value 0.001) mainly due to a higher methylation of IGF2 DMR in Wharton jelly (mean 0.65, sd 0.14) and a lower methylation of H19 in placental tissue (mean 0.25, sd 0.02) compared to other tissues. This study demonstrates the feasibility of the assessment of differential tissue specific DNA methylation. Although the results have to be confirmed in larger sample sizes, our approach gives opportunities to investigate epigenetic profiles as underlying mechanism of associations between pregnancy exposures and outcome, and disease risks in later life.

Detection of transgenic and endogenous plant DNA fragments in the blood, tissues, and digesta of broilers

The aim was to determine the fate of transgenic and endogenous plant DNA fragments in the blood, tissues, and digesta of broilers. Male broiler chicks (n = 24) were allocated at 1 day old to each of four treatment diets designated T1-T4. T1 and T2 contained the near isogenic nongenetically modified (GM) maize grain, whereas T3 and T4 contained GM maize grain [cry1a(b) gene]; T1 and T3 also contained the near isogenic non-GM soybean meal, whereas T2 and T4 contained GM soybean meal (cp4epsps gene). Four days prior to slaughter at 39-42 days old, 50% of the broilers on T2-T4 had the source(s) of GM ingredients replaced by their non-GM counterparts. Detection of specific DNA sequences in feed, tissue, and digesta samples was completed by polymerase chain reaction analysis. Seven primer pairs were used to amplify fragments (similar to 200 bp) from single copy genes (maize high mobility protein, soya lectin, and transgenes in the GM feeds) and multicopy genes (poultry mitochondrial cytochrome b, maize, and soya rubisco). There was no effect of treatment on the measured growth performance parameters. Except for a single detection of lectin (nontransgenic single copy gene; unsubstantiated) in the extracted DNA from one bursa tissue sample, there was no positive detection of any endogenous or transgenic single copy genes in either blood or tissue DNA samples. However, the multicopy rubisco gene was detected in a proportion of samples from all tissue types (23% of total across all tissues studied) and in low numbers in blood. Feed-derived DNA was found to survive complete degradation up to the large intestine. Transgenic DNA was detected in gizzard digesta but not in intestinal digesta 96 h after the last feeding of treatment diets containing a source of GM maize and/or soybean meal.

Detecting recombination in 4-taxa DNA sequence alignments with Bayesian hidden Markov models and Markov chain Monte Carlo

This article presents a statistical method for detecting recombination in DNA sequence alignments, which is based on combining two probabilistic graphical models: (1) a taxon graph (phylogenetic tree) representing the relationship between the taxa, and (2) a site graph (hidden Markov model) representing interactions between different sites in the DNA sequence alignments. We adopt a Bayesian approach and sample the parameters of the model from the posterior distribution with Markov chain Monte Carlo, using a Metropolis-Hastings and Gibbs-within-Gibbs scheme. The proposed method is tested on various synthetic and real-world DNA sequence alignments, and we compare its performance with the established detection methods RECPARS, PLATO, and TOPAL, as well as with two alternative parameter estimation schemes.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

DNA barcodes for Mexican Cactaceae, plants under pressure from wild collecting

DNA barcodes could be a useful tool for plant conservation. Of particular importance is the ability to identify unknown plant material, such as from customs seizures of illegally collected specimens. Mexican cacti are an example of a threatened group, under pressure because of wild collection for the xeriscaping trade and private collectors. Mexican cacti also provide a taxonomically and geographically coherent group with which to test DNA barcodes. Here, we sample the matK barcode for 528 species of Cactaceae including approximately 75% of Mexican species and test the utility of the matK region for species-level identification. We find that the matK DNA barcode can be used to identify uniquely 77% of species sampled, and 79-87% of species of particular conservation importance. However, this is far below the desired rate of 95% and there are significant issues for PCR amplification because of the variability of primer sites. Additionally, we test the nuclear ITS regions for the cactus subfamily Opuntioideae and for the genus Ariocarpus (subfamily Cactoideae). We observed higher rates of variation for ITS (86% unique for Opuntioideae sampled) but a much lower PCR success, encountering significant intra-individual polymorphism in Ariocarpus precluding the use of this marker in this taxon. We conclude that the matK region should provide useful information as a DNA barcode for Cactaceae if the problems with primers can be addressed, but matK alone is not sufficiently variable to achieve species-level identification. Additional complementary regions should be investigated as ITS is shown to be unsuitable

Analysis of DNA polymorphism in ancient barley herbarium material: validation of the KASP SNP genotyping platform

The availability of crop specimens archived in herbaria and old seed collections represent valuable resources for the analysis of plant genetic diversity and crop domestication. The ability to extract ancient DNA (aDNA) from such samples has recently allowed molecular genetic investigations to be undertaken in ancient materials. While analyses of aDNA initially focused on the use of markers which occur in multiple copies such as the internal transcribed spacer region (ITS) within ribosomal DNA and those requiring amplification of short DNA regions of variable length such as simple sequence repeats (SSRs), emphasis is now moving towards the genotyping of single nucleotide polymorphisms (SNPs), traditionally undertaken in aDNA by Sanger sequencing. Here, using a panel of barley aDNA samples previously surveyed by Sanger sequencing for putative causative SNPs within the flowering-time gene PPD-H1, we assess the utility of the Kompetitive Allele Specific PCR (KASP) genotyping platform for aDNA analysis. We find KASP to out-perform Sanger sequencing in the genotyping of aDNA samples (78% versus 61% success, respectively), as well as being robust to contamination. The small template size (≥46 bp) and one-step, closed-tube amplification/genotyping process make this platform ideally suited to the genotypic analysis of aDNA, a process which is often hampered by template DNA degradation and sample cross-contamination. Such attributes, as well as its flexibility of use and relatively low cost, make KASP particularly relevant to the genetic analysis of aDNA samples. Furthermore, KASP provides a common platform for the genotyping and analysis of corresponding SNPs in ancient, landrace and modern plant materials. The extended haplotype analysis of PPD-H1 undertaken here (allelic variation at which is thought to be important for the spread of domestication and local adaptation) provides further resolution to the previously identified geographic cline of flowering-time allele distribution, illustrating how KASP can be used to aid genetic analyses of aDNA from plant species. We further demonstrate the utility of KASP by genotyping ten additional genetic markers diagnostic for morphological traits in barley, shedding light on the phenotypic traits, alleles and allele combinations present in these unviable ancient specimens, as well as their geographic distributions.

Controlled dehydration of a ruthenium complex-DNA crystal induces reversible DNA kinking

Hydration-dependent DNA deformation has been known since Rosalind Franklin recognised that the relative humidity of the sample had to be maintained to observe a single conformation in DNA fibre diffraction. We now report for the first time the crystal structure, at the atomic level, of a dehydrated form of a DNA duplex and demonstrate the reversible interconversion to the hydrated form at room temperature. This system, containing d(TCGGCGCCGA) in the presence of Λ-[Ru(TAP)2(dppz)]2+ (TAP = 1,4,5,8-tetraazaphenanthrene, dppz = dipyridophenazine), undergoes a partial transition from an A/B hybrid to the A-DNA conformation, at 84-79% relative humidity. This is accompanied by an increase in kink at the central step from 22° to 51°, with a large movement of the terminal bases forming the intercalation site. This transition is reversible on rehydration. Seven datasets, collected from one crystal at room temperature, show the consequences of dehydration at near-atomic resolution. This result highlights that crystals, traditionally thought of as static systems, are still dynamic and therefore can be the subject of further experimentation.

Successful carnivore identification with faecal DNA across a fragmented Amazonian landscape

The use of scat surveys to obtain DNA has been well documented in temperate areas, where DNA preservation may be more effective than in tropical forests. Samples obtained in the tropics are often exposed to high humidity, warm temperatures, frequent rain and intense sunlight, all of which can rapidly degrade DNA. Despite these potential problems, we demonstrate successful mtDNA amplification and sequencing for faeces of carnivores collected in tropical conditions and quantify how sample condition and environmental variables influence the success of PCR amplification and species identification. Additionally, the feasibility of genotyping nuclear microsatellites from jaguar (Panthera onca) faeces was investigated. From October 2007 to December 2008, 93 faecal samples were collected in the southern Brazilian Amazon. A total of eight carnivore species was successfully identified from 71% of all samples obtained. Information theoretic analysis revealed that the number of PCR attempts before a successful sequence was an important negative predictor across all three responses (success of species identification, success of species identification from the first sequence and PCR amplification success), whereas the relative importance of the other three predictors (sample condition, season and distance from forest edge) varied between the three responses. Nuclear microsatellite amplification from jaguar faeces had lower success rates (15-44%) compared with those of the mtDNA marker. Our results show that DNA obtained from faecal samples works efficiently for carnivore species identification in the Amazon forest and also shows potential for nuclear DNA analysis, thus providing a valuable tool for genetic, ecological and conservation studies.

DGGE with genomic DNA: Suitable for detection of numerically important organisms but not for identification of the most abundant organisms

Identification of all important community members as well as of the numerically dominant members of a community are key aspects of microbial community analysis of bioreactor samples. A systematic study was conducted with artificial consortia to test whether denaturing gradient gel electrophoresis (DGCE) is a reliable technique to obtain such community data under conditions where results would not be affected by differences in DNA extraction efficiency from cells. A total of 27 consortia were established by mixing DNA extracted from Escherichia coli K12, Burkholderia cepacia and Stenotrophomonas maltophilia in different proportions. Concentrations of DNA of single organisms in the consortia were either 0.04, 0.4 or 4 ng/mu l. DGGE-PCR of genomic DNA with primer sets targeted at the V3 and V6-V8 regions of the 16S rDNA failed to detect the three community members in only 7% of consortia, but provided incorrect information about dominance or co-dominance for 85% and 89% of consortia with the primer sets for the V6-V8 and V3 regions, respectively. The high failure rate in detection of dominant B. cepacia with the primers for the V6-V8 region was attributable to a single nucleoticle primer mismatch in the target sequences of both, the forward and reverse primer. Amplification bias in PCR of E. coli and S. maltophilia for the V6-V8 region and for all three organisms for the V3 region occurred due to interference of genomic DNA in PCR-DGGE, since a nested PCR approach, where PCR-DGGE was started from mixtures of 16S rRNA genes of the organisms, provided correct information about the relative abundance of original DNA in the sample. Multiple bands were not observed in pure culture amplicons produced with the V6-V8 primer pair, but pure culture V3 DGGE profiles of E. coli, S. maltophilia and B. cepacia contained 5, 3 and 3 bands, respectively. These results demonstrate DGGE was suitable for identification of all important community members in the three-membered artificial consortium, but not for identification of the dominant organisms in this small community. Multiple DGGE bands obtained for single organisms with the V3 primer pair could greatly confound interpretation of DGGE profiles. (C) 2008 Elsevier Ltd. All rights reserved.

Mass spectrometric investigation of the DNA-binding properties of an anthracycline with two trisaccharide chains

Cosmomycin D (CosD) is an anthracycline that has two trisaccharide chains linked to its ring system. Gel electrophoresis showed that CosD formed stable complexes with plasmid DNA under conditions where daunorubicin (Dn) and doxorubicin (Dx) dissociated to some extent during the experiments. The footprint and stability of CosD complexed with 10- and 16 trier DNA was investigated using several applications of electrospray ionisation mass spectrometry (ESI-MS). ESI-MS binding profiles showed that fewer CosD molecules bound to the sequences than Dn or Dx. In agreement with this, ESI-MS analysis of nuclease digestion products of the complexes showed that CosD protected the DNA to a greater extent than Dn or Dx. In tandem MS experiments, all CosD-DNA complexes were more stable than Dn- and Dx-DNA complexes. These results Support that CosD binds more tightly to DNA and exerts a larger footprint than ESI-MS investigations of the binding properties of CosD Could be carried out rapidly and using only small amounts of sample. (C) 2008 Elsevier Inc. All rights reserved.