Modified design procedure for a sparger reactor sequence

In an earlier communication[l] we have indicated a general graphical design procedure for a sequence of sparger reactors in which a second order liquid phase reaction proceeds in a stagewise fashion. The prediction of the reactant concentration in each stage and hence the conversion depended on a search procedure initiated along a straight line representing the mass balance equation at the given stage and drawn from the known feed stage located on the abscissa in a E-IU diagram for the given system.

Infrared thermal imaging for automated detection of diabetic foot complications

Background Although thermal imaging can be a valuable technology in the prevention and management of diabetic foot disease, it is not yet widely used in clinical practice. Technological advancement in infrared imaging increases its application range. The aim was to explore the first steps in the applicability of high-resolution infrared thermal imaging for noninvasive automated detection of signs of diabetic foot disease. Methods The plantar foot surfaces of 15 diabetes patients were imaged with an infrared camera (resolution, 1.2 mm/pixel): 5 patients had no visible signs of foot complications, 5 patients had local complications (e.g., abundant callus or neuropathic ulcer), and 5 patients had difuse complications (e.g., Charcot foot, infected ulcer, or critical ischemia). Foot temperature was calculated as mean temperature across pixels for the whole foot and for specified regions of interest (ROIs). Results No diferences in mean temperature >1.5 °C between the ipsilateral and the contralateral foot were found in patients without complications. In patients with local complications, mean temperatures of the ipsilateral and the contralateral foot were similar, but temperature at the ROI was >2 °C higher compared with the corresponding region in the contralateral foot and to the mean of the whole ipsilateral foot. In patients with difuse complications, mean temperature diferences of >3 °C between ipsilateral and contralateral foot were found. Conclusions With an algorithm based on parameters that can be captured and analyzed with a high-resolution infrared camera and a computer, it is possible to detect signs of diabetic foot disease and to discriminate between no, local, or difuse diabetic foot complications. As such, an intelligent telemedicine monitoring system for noninvasive automated detection of signs of diabetic foot disease is one step closer. Future studies are essential to confirm and extend these promising early findings.

Automatic detection of diabetic foot complications with infrared thermography by asymmetric analysis

Early identification of diabetic foot complications and their precursors is essential in preventing their devastating consequences, such as foot infection and amputation. Frequent, automatic risk assessment by an intelligent telemedicine system might be feasible and cost effective. Infrared thermography is a promising modality for such a system. The temperature differences between corresponding areas on contralateral feet are the clinically significant parameters. This asymmetric analysis is hindered by (1) foot segmentation errors, especially when the foot temperature and the ambient temperature are comparable, and by (2) different shapes and sizes between contralateral feet due to deformities or minor amputations. To circumvent the first problem, we used a color image and a thermal image acquired synchronously. Foot regions, detected in the color image, were rigidly registered to the thermal image. This resulted in 97.8% ± 1.1% sensitivity and 98.4% ± 0.5% specificity over 76 high-risk diabetic patients with manual annotation as a reference. Nonrigid landmark-based registration with Bsplines solved the second problem. Corresponding points in the two feet could be found regardless of the shapes and sizes of the feet. With that, the temperature difference of the left and right feet could be obtained.

Sequence of reactions leading to cytochrome-p-450 synthesis-effect of drugs

The effect of phenobarbital on the rates of the synthesis of the protein and heme moieties of cytochrome P-450 has been studied. For this purpose, cytochrome P-450 has been partially purified as its P-420 derivative and the labeled amino acid incorporation into the protein has been studied after subjecting a partially purified preparation to sodium dodecyl sulfate gel electrophoresis. The incorporation studies into the protein species after sodium dodecyl sulfate gel electrophoresis reveal that the drug primarily accelerates the rate of apoprotein synthesis followed by an increase in the rate of heme synthesis. The messenger for apocytochrome P-450 appears to be fairly stable.

Sequence distribution in Acrylonitrile-methylacrylate random copolymers by N.M.R spectroscopy

The sequence distribution studies on the acrylonitrile-methylmethacrylate copolymer of high methylmethacrylate (M) content (30%sequences is indicated by the pattern of a-methyl protons.

Rhizoctonia -Scots pine interactions: detection, impact on seedling performance and host defence gene response

Rhizoctonia spp. are ubiquitous soil inhabiting fungi that enter into pathogenic or symbiotic associations with plants. In general Rhizoctonia spp. are regarded as plant pathogenic fungi and many cause root rot and other plant diseases which results in considerable economic losses both in agriculture and forestry. Many Rhizoctonia strains enter into symbiotic mycorrhizal associations with orchids and some hypovirulent strains are promising biocontrol candidates in preventing host plant infection by pathogenic Rhizoctonia strains. This work focuses on uni- and binucleate Rhizoctonia (respectively UNR and BNR) strains belonging to the teleomorphic genus Ceratobasidium, but multinucleate Rhizoctonia (MNR) belonging to teleomorphic genus Thanatephorus and ectomycorrhizal fungal species, such as Suillus bovinus, were also included in DNA probe development work. Strain specific probes were developed to target rDNA ITS (internal transcribed spacer) sequences (ITS1, 5.8S and ITS2) and applied in Southern dot blot and liquid hybridization assays. Liquid hybridization was more sensitive and the size of the hybridized PCR products could be detected simultaneously, but the advantage in Southern hybridization was that sample DNA could be used without additional PCR amplification. The impacts of four Finnish BNR Ceratorhiza sp. strains 251, 266, 268 and 269 were investigated on Scot pine (Pinus sylvestris) seedling growth, and the infection biology and infection levels were microscopically examined following tryphan blue staining of infected roots. All BNR strains enhanced early seedling growth and affected the root architecture, while the infection levels remained low. The fungal infection was restricted to the outer cortical regions of long roots and typical monilioid cells detected with strain 268. The interactions of pathogenic UNR Ceratobasidium bicorne strain 1983-111/1N, and endophytic BNR Ceratorhiza sp. strain 268 were studied in single or dual inoculated Scots pine roots. The fungal infection levels and host defence-gene activity of nine transcripts [phenylalanine ammonia lyase (pal1), silbene synthase (STS), chalcone synthase (CHS), short-root specific peroxidase (Psyp1), antimicrobial peptide gene (Sp-AMP), rapidly elicited defence-related gene (PsACRE), germin-like protein (PsGER1), CuZn- superoxide dismutase (SOD), and dehydrin-like protein (dhy-like)] were measured from differentially treated and un-treated control roots by quantitative real time PCR (qRT-PCR). The infection level of pathogenic UNR was restricted in BNR- pre-inoculated Scots pine roots, while UNR was more competitive in simultaneous dual infection. The STS transcript was highly up-regulated in all treated roots, while CHS, pal1, and Psyp1 transcripts were more moderately activated. No significant activity of Sp-AMP, PsACRE, PsGER1, SOD, or dhy-like transcripts were detected compared to control roots. The integrated experiments presented, provide tools to assist in the future detection of these fungi in the environment and to understand the host infection biology and defence, and relationships between these interacting fungi in roots and soils. This study further confirms the complexity of the Rhizoctonia group both phylogenetically and in their infection biology and plant host specificity. The knowledge obtained could be applied in integrated forestry nursery management programmes.

Immunological studies on nucleic-acids and their components .5. Antibodies specific to a deoxyribodinucleotide sequence

Antibodies were raised in rabbits against the bovine serum albumin conjugate of dpApT. Analysis by double diffusion in agar gel and quantitative precipitation test showed the presence of antibodies specific to the hapten in the antisera. Quantitative data on the specificity of the antibodies were obtained by studying the inhibition of the binding of 3H-dpApT to the anti-sera by various nonradioactive mono- and oligonucleotides, using a nitrocellulose membrane binding assay. The antibodies were found to be highly specific for the dinucleotide sequence dpApT. The antibodies were able to bind to synthetic oligonucleotides containing the sequence dpApT and to denatured calf thymus DNA.

Quarantine and surveillance strategies for plant pathogen detection and control

Incursions of plant pests and diseases pose serious threats to food security, agricultural productivity and the natural environment. One of the challenges in confidently delimiting and eradicating incursions is how to choose from an arsenal of surveillance and quarantine approaches in order to best control multiple dispersal pathways. Anthropogenic spread (propagules carried on humans or transported on produce or equipment) can be controlled with quarantine measures, which in turn can vary in intensity. In contrast, environmental spread processes are more difficult to control, but often have a temporal signal (e.g. seasonality) which can introduce both challenges and opportunities for surveillance and control. This leads to complex decisions regarding when, where and how to search. Recent modelling investigations of surveillance performance have optimised the output of simulation models, and found that a risk-weighted randomised search can perform close to optimally. However, exactly how quarantine and surveillance strategies should change to reflect different dispersal modes remains largely unaddressed. Here we develop a spatial simulation model of a plant fungal-pathogen incursion into an agricultural region, and its subsequent surveillance and control. We include structural differences in dispersal via the interplay of biological, environmental and anthropogenic connectivity between host sites (farms). Our objective was to gain broad insights into the relative roles played by different spread modes in propagating an invasion, and how incorporating knowledge of these spread risks may improve approaches to quarantine restrictions and surveillance. We find that broad heuristic rules for quarantine restrictions fail to contain the pathogen due to residual connectivity between sites, but surveillance measures enable early detection and successfully lead to suppression of the pathogen in all farms. Alternative surveillance strategies attain similar levels of performance by incorporating environmental or anthropogenic dispersal risk in the prioritisation of sites. Our model provides the basis to develop essential insights into the effectiveness of different surveillance and quarantine decisions for fungal pathogen control. Parameterised for authentic settings it will aid our understanding of how the extent and resolution of interventions should suitably reflect the spatial structure of dispersal processes.

Tributyltin chloride-sodium cyanoborohydride mediated tandem radical cyclisation-reductive demethoxylation sequence

Reaction of the bromoketals 3, 7a-g and 11 with tri-n-butyltin chloride and sodium cyanoborohydride in the presence of a catalytic amount of AIBN furnished the ethers 5, 8a-g and 13 via a tandem sequence comprising of a radical cyclisation reaction and tri-n-butylhalostannane and sodium cyanoborohydride mediated reductive demethoxylation of the resulting cyclic ketals.

Nucleotide sequence of the 3' terminal region of belladonna mottle virus-Iowa (renamed Physalis mottle virus) RNA and an analysis of the relationships of tymoviral coat proteins

The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Characterization of sequence and structural features of the Candida krusei Enolase

The incidence of human infections by the fungal pathogen Candida species has been increasing in recent years. Enolase is an essential protein in fungal metabolism. Sequence data is available for human and a number of medically important fungal species. An understanding of the structural and functional features of fungal enolases may provide the structural basis for their use as a target for the development of new anti-fungal drugs. We have obtained the sequence of the enolase of Candida krusei (C. krusei), as it is a significant medically important fungal pathogen. We have then used multiple sequence alignments with various enolase isoforms in order to identify C. krusei specific amino acid residues. The phylogenetic tree of enolases shows that the C. krusei enolase assembles on the tree with the fungal genes. Importantly, C. krusei lacks four amino acids in the active site compared to human enolase, as revealed by multiple sequence alignments. These differences in the substrate binding site may be exploited for the design of new anti-fungal drugs to selectively block this enzyme. The lack of the important amino acids in the active site also indicates that C. krusei enolase might have evolved as a member of a mechanistically diverse enolase superfamily catalying somewhat different reactions.

A common epitope of beta-lactoglobulin and serum retinol-binding proteins: Elucidation of its core sequence using synthetic peptides

One of the monoclonal antibodies raised against bovine beta-lactoglobulin reacted with human serum retinol binding protein. The finding that this monoclonal antibody also reacted with the serum retinol binding proteins isolated from other animals, suggested that this epitopic conformation is conserved among these proteins. Using ELISA and various synthetic peptides of defined sequence, we show in this paper that the epitope defined by this monoclonal antibody comprises of the highly conserved core sequence of DTDY present in beta-lactoglobulin and retinol binding proteins.

vSpeak: Edge detection based feature extraction for sign to text conversion

This paper presents 'vSpeak', the first initiative taken in Pakistan for ICT enabled conversion of dynamic Sign Urdu gestures into natural language sentences. To realize this, vSpeak has adopted a novel approach for feature extraction using edge detection and image compression which gives input to the Artificial Neural Network that recognizes the gesture. This technique caters for the blurred images as well. The training and testing is currently being performed on a dataset of 200 patterns of 20 words from Sign Urdu with target accuracy of 90% and above.

Acoustic emission source location and damage detection in a metallic structure using a graph-theory-based geodesic pproach

A geodesic-based approach using Lamb waves is proposed to locate the acoustic emission (AE) source and damage in an isotropic metallic structure. In the case of the AE (passive) technique, the elastic waves take the shortest path from the source to the sensor array distributed in the structure. The geodesics are computed on the meshed surface of the structure using graph theory based on Dijkstra's algorithm. By propagating the waves in reverse virtually from these sensors along the geodesic path and by locating the first intersection point of these waves, one can get the AE source location. The same approach is extended for detection of damage in a structure. The wave response matrix of the given sensor configuration for the healthy and the damaged structure is obtained experimentally. The healthy and damage response matrix is compared and their difference gives the information about the reflection of waves from the damage. These waves are backpropagated from the sensors and the above method is used to locate the damage by finding the point where intersection of geodesics occurs. In this work, the geodesic approach is shown to be suitable to obtain a practicable source location solution in a more general set-up on any arbitrary surface containing finite discontinuities. Experiments were conducted on aluminum specimens of simple and complex geometry to validate this new method.