902 resultados para Specific Educational Needs
Resumo:
The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.
Resumo:
Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.
Resumo:
The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).
Resumo:
The objective of this article is to examine the current government proposal of racialization in the Brazilian population, in order to offer support to affirmative action programs that meet the specific needs of those who classify themselves as black. Firstly we focused on the revival of the notion of race among scholars, politicians, and anti-racism activists, as well as on the difficulty in determining who is black in Brazil. Next we examined the racial quota system in the United States and its proclaimed success. Finally, we assessed the extent to which the introduction of racial quota in employment and university enrollment should be imposed as the sole political option for those intending to eliminate racism in Brazilian society.
Resumo:
The chemical industries worldwide are passing through a very particular moment of re-adaptation due to the implementation of an European regulation called, Registration, Evaluation, Authorization and Restriction of Chemicals (REACH). In Brazil, the Brazilian Chemical Industry needs urgently a specific guide of chemical products stability. The main purpose of this work is to present a proposal of a guide of stability for chemical products based on the reference guides of the International Conference on Harmonization (ICH). Thus, this work proposes an innovation in terms of methodology which will be useful for shelf life definition purpose for chemical industry products.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Purpose:1) To check self-knowledge and needs for orientation among regular class teachers working with low vision students; 2) To gather information to assist the training on visual deficiency of regular class teachers. Methods: A survey was conducted for the academic year of 1999 among those teachers working in public schools, Campinas/SP/Brazil, of which 11 were municipal and 9 state schools, respectively 79.0% and 90.0% of these schools. A self-administered questionnaire was used as data collection instrument. Results: The sample was composed of 50 teachers with a regular class experience averaging 20 years. Most of them, 94.0%, said that they had no specific preparation in the area of low vision. Only 18 teachers declared to have received some kind of information/orientation in order to work with their low vision students and of those only 15 teachers mentioned the kind of orientation received. The whole group of 50 declared interest in receiving information. From the information/orientation requested 66.0% mentioned extended working class materials, 50.0% visual performance and eye disease of their students and 46.0% visual acuity/visual field. Conclusion: It was detected that teachers of regular classes received none or little information about their low vision students but demonstrated interest in its obtention. It was also shown that those teachers are not prepared to work with visually impaired children.
Resumo:
Purpose: To identify improvement in visual performance of low vision students after assessment and management conducted at the Low Vision Service of State University of Campinas (UNICAMP). Method: Fourteen low vision students aged six to 30 years, attended in a room with resources for visual deficiency in Americana and Santa Bárbara d'Oeste -- SP during 1998 received complete ophthalmologic examination, specialized low vision assessment and educational intervention. Results: The most prevalent cause of vision loss was operated congenital cataract with four cases (28.6%), followed by congenital bilateral toxoplasmic macular scars and eye malformation, both with two cases (14.3%) cases each. Eight students (57.2%) had acuity classified as severe vision loss, four (28.6%) profound, one (7.1%) moderate and one (7.1%) nearly normal vision. Twelve (85.7%) were behind expected school grade. Optical aids were prescribed for 12 (85.8%) students but only 7 (58.3%) acquired the aids thus improving significantly their school performance. Conclusion: All students improved school performance even considering that 12 (85.7%) had severe to profound vision loss. As a group their performance could even be better if the optical aid prescriptions were acquired by all. This indicates the need of a social work to support such needs. For good results at school and effective student inclusion a partnership between school, family and specialized education is necessary. We recommend to promote the benefits of the resource room.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física