981 resultados para SOIL MICROBIAL COMMUNITY
Resumo:
Quantifying global patterns of terrestrial nitrogen (N) cycling is central to predicting future patterns of primary productivity, carbon sequestration, nutrient fluxes to aquatic systems, and climate forcing. With limited direct measures of soil N cycling at the global scale, syntheses of the (15)N:(14)N ratio of soil organic matter across climate gradients provide key insights into understanding global patterns of N cycling. In synthesizing data from over 6000 soil samples, we show strong global relationships among soil N isotopes, mean annual temperature (MAT), mean annual precipitation (MAP), and the concentrations of organic carbon and clay in soil. In both hot ecosystems and dry ecosystems, soil organic matter was more enriched in (15)N than in corresponding cold ecosystems or wet ecosystems. Below a MAT of 9.8°C, soil δ(15)N was invariant with MAT. At the global scale, soil organic C concentrations also declined with increasing MAT and decreasing MAP. After standardizing for variation among mineral soils in soil C and clay concentrations, soil δ(15)N showed no consistent trends across global climate and latitudinal gradients. Our analyses could place new constraints on interpretations of patterns of ecosystem N cycling and global budgets of gaseous N loss.
Resumo:
The present work aimed to investigate the diversity of bacteria and filamentous fungi of southern Atlantic Ocean marine sponge Dragmacidon reticulatum using cultivation-independent approaches. Fungal ITS rDNA and 18S gene analyses (DGGE and direct sequencing approaches) showed the presence of representatives of three order (Polyporales, Malasseziales, and Agaricales) from the phylum Basidiomycota and seven orders belonging to the phylum Ascomycota (Arthoniales, Capnodiales, Dothideales, Eurotiales, Hypocreales, Pleosporales, and Saccharomycetales). On the other hand, bacterial 16S rDNA gene analyses by direct sequencing approach revealed the presence of representatives of seven bacterial phyla (Cyanobacteria, Proteobacteria, Actinobacteria, Bacteroidetes, Lentisphaerae, Chloroflexi, and Planctomycetes). Results from statistical analyses (rarefaction curves) suggested that the sampled clones covered the fungal diversity in the sponge samples studied, while for the bacterial community additional sampling would be necessary for saturation. This is the first report related to the molecular analyses of fungal and bacterial communities by cultivation-independent approaches in the marine sponges D. reticulatum. Additionally, the present work broadening the knowledge of microbial diversity associated to marine sponges and reports innovative data on the presence of some fungal genera in marine samples.
Mineral Nutrition Of Campos Rupestres Plant Species On Contrasting Nutrient-impoverished Soil Types.
Resumo:
In Brazil, the campos rupestres occur over the Brazilian shield, and are characterized by acidic nutrient-impoverished soils, which are particularly low in phosphorus (P). Despite recognition of the campos rupestres as a global biodiversity hotspot, little is known about the diversity of P-acquisition strategies and other aspects of plant mineral nutrition in this region. To explore nutrient-acquisition strategies and assess aspects of plant P nutrition, we measured leaf P and nitrogen (N) concentrations, characterized root morphology and determined the percentage arbuscular mycorrhizal (AM) colonization of 50 dominant species in six communities, representing a gradient of soil P availability. Leaf manganese (Mn) concentration was measured as a proxy for carboxylate-releasing strategies. Communities on the most P-impoverished soils had the highest proportion of nonmycorrhizal (NM) species, the lowest percentage of mycorrhizal colonization, and the greatest diversity of root specializations. The large spectrum of leaf P concentration and variation in root morphologies show high functional diversity for nutritional strategies. Higher leaf Mn concentrations were observed in NM compared with AM species, indicating that carboxylate-releasing P-mobilizing strategies are likely to be present in NM species. The soils of the campos rupestres are similar to the most P-impoverished soils in the world. The prevalence of NM strategies indicates a strong global functional convergence in plant mineral nutrition strategies among severely P-impoverished ecosystems.
Resumo:
The objectives were to identify factors associated with decreased life satisfaction in community-dwelling elderly and describe such factors according to gender and age bracket. The study interviewed 2,472 elderly individuals 65 years or older without cognitive deficits suggestive of dementia, in probabilistic samples from seven Brazilian cities. All measures were self-reported except for functional performance, indicated by handgrip and gait speed. Women had more chronic diseases, worse functional performance, and greater social involvement when compared to men. The oldest participants showed worse functional performance and less social involvement when compared to the youngest. Low satisfaction was associated with three or more diseases, memory problems, low social involvement, low handgrip strength, and urinary incontinence. The authors conclude that health, functional performance, and social involvement interact with well-being, so interventions targeting these areas can favor quality of life for the elderly.
Resumo:
We analyzed the structure of the understory community in the Atlantic Forest sensu lato, for which phytosociological descriptions of the understory are lacking. We delineated 50 plots of 10 × 20 m each at four sites within an Araucaria forest (a subtype of Atlantic Forest), located in the municipalities of Bananal, Campos do Jordão, Itaberá and Barra do Chapéu, all of which are in the state of São Paulo, Brazil. To sample the resident species of the understory, we randomly selected five 1 × 1 m subplots within each plot, resulting in a total sampling area of 250 m² at each site. We identified differences among the locations, mostly due to proportional differences in growth forms, in terms of species richness and the importance values within the community. Factors potentially influencing the understory structure include macroclimatic and microclimatic conditions, as well as forest fragmentation, the abundance of deciduous trees in the canopy, the surrounding vegetation and geographic location.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The aim of this study was to evaluate the microbial distribution in the root canal system after periapical lesion induction in dogs' teeth using different methods. Fifty-two root canals were assigned to 4 groups (n=13). Groups I and II: root canals were exposed to the oral cavity for 180 days; groups III and IV: root canals were exposed for 7 days and then the coronal openings were sealed for 53 days. The root apices of groups I and III were perforated, while those of groups II and IV remained intact. After the experimental periods, the animals were euthanized and the anatomic pieces containing the roots were processed and stained with the Brown & Brenn method to assess the presence and distribution of microorganisms. The incidence of microorganisms at different sites of the roots and periapical lesions was analyzed statistically by the chi-square test at 5% significance level. All groups presented microorganisms in the entire root canal system. A larger number of microorganisms was observed on the root canal walls, apical delta and dentinal tubules (p<0.05), followed by cementum and cemental resorption areas. In spite of the different periods of exposure to the oral environment, the methods used for induction of periapical periodontitis yielded similar distribution of microorganisms in the root canal system.
Resumo:
Application of calcium silicate (SiCa) as soil acidity corrective was evaluated in a Rhodic Hapludox soil with palisade grass conducted under pasture rotation system with different grazing intensities. Experimental design was complete randomized blocks with four grazing intensities - grazing intensities were imposed by forage supply (50, 100, 150 and 200 kg t-1 of DM per LW) - in experimental plots with four replicates and, in the subplots, with seven doses of calcium silicate combined with lime: 0+0, 2+0, 4+0, 6+0, 2+4, 4+2 and 0+6 t ha-1, respectively. In the soil, it was evaluated the effect of four levels of calcium silicate (0, 2, 4 and 6 t ha-1) at 45, 90, and 365 days at three depths (0-10, 10-20 and 20-40 cm) and at 365 days, it was included one level of lime (6 t ha-1). For determination of leaf chemical composition and silicate content in the soil, four levels of calcium silicate (0, 2, 4 and 6 t ha-1) were evaluated at 45 and 365 days and at 45 days only for leaf silicate, whereas for dry matter production, all corrective treatments applied were evaluated in evaluation seasons. Application of calcium silicate was positive for soil chemical traits related to acidity correction (pH(CaCl2), Ca, Mg, K, H+Al and V), but the limestone promoted better results at 365 days. Leaf mineral contents were not influenced by application of calcium silicate, but there was an increase on silicate contents in leaves and in the soil. Dry matter yield and chemical composition of palisade grass improved with the application of correctives.
Resumo:
Gaseous N losses from soil are considerable, resulting mostly from ammonia volatilization linked to agricultural activities such as pasture fertilization. The use of simple and accessible measurement methods of such losses is fundamental in the evaluation of the N cycle in agricultural systems. The purpose of this study was to evaluate quantification methods of NH3 volatilization from fertilized surface soil with urea, with minimal influence on the volatilization processes. The greenhouse experiment was arranged in a completely randomized design with 13 treatments and five replications, with the following treatments: (1) Polyurethane foam (density 20 kg m-3) with phosphoric acid solution absorber (foam absorber), installed 1, 5, 10 and 20 cm above the soil surface; (2) Paper filter with sulfuric acid solution absorber (paper absorber, 1, 5, 10 and 20 cm above the soil surface); (3) Sulfuric acid solution absorber (1, 5 and 10 cm above the soil surface); (4) Semi-open static collector; (5) 15N balance (control). The foam absorber placed 1 cm above the soil surface estimated the real daily rate of loss and accumulated loss of NH3N and proved efficient in capturing NH3 volatized from urea-treated soil. The estimates based on acid absorbers 1, 5 and 10 cm above the soil surface and paper absorbers 1 and 5 cm above the soil surface were only realistic for accumulated N-NH3 losses. Foam absorbers can be indicated to quantify accumulated and daily rates of NH3 volatilization losses similarly to an open static chamber, making calibration equations or correction factors unnecessary.
Resumo:
RATIONALE: Benign focal seizures of adolescence (BFSA) described by Loiseau et al in 1972, is considered a rare entity, but maybe underdiagnosed. Although mild neuropsychological deficits have been reported in patients with benign epilepsies of childhood, these evaluations have not so far been described in BFSA. The aim of this study is to evaluate neuropsychological functions in BFSA with new onset seizures (<12 months). METHODS: Eight patients with BFSA (according to Loiseau et al, 1972, focal or secondarily tonic clonic generalized seizures between the ages of 10-18 yrs., normal neurologic examination, normal EEG or with mild focal abnormalities) initiated in the last 12 months were studied between July 2008 to May 2009. They were referred from the Pediatric Emergency Section of the Hospital Universitário of the University of Sao Paulo, a secondary care regionalized facility located in a district of middle-low income in Sao Paulo city, Brazil. The study was approved by the Ethics Committee of the Institution. All patients performed neurological, EEG, brain CT and neuropsychological evaluation which consisted of Raven's Special Progressive Matrices - General and Special Scale (according to different ages), Wechsler Children Intelligence Scale-WISC III with ACID Profile, Trail Making Test A/B, Stroop Test, Bender Visuo-Motor Test, Rey Complex Figure, Rey Auditory Verbal Learning Test-RAVLT, Boston Naming Test, Fluency Verbal for phonological and also conceptual patterns - FAS/Animals and Hooper Visual Organization Test. For academic achievement, we used a Brazilian test for named "Teste do Desempenho Escolar", which evaluates abilities to read, write and calculate according to school grade. RESULTS: There were 2 boys and 6 girls, with ages ranging from 10 yrs. 9 m to 14 yrs. 3 m. Most (7/8) of the patients presented one to two seizures and only three of them received antiepileptic drugs (AEDs). Six had mild EEG focal abnormalities and all had normal brain CT. All were literate, attended regular public schools and scored in a median range for IQ, and seven showed discrete higher scores for the verbal subtests. There were low scores for attention in different modalities in six patients, mainly in alternated attention as well as inhibitory subtests (Stroop test and Trail Making Test part B). Four of the latter cases who showed impairment both in alternated and inhibitory attention were not taking AEDs. Visual memory was impaired in five patients (Rey Complex Figure). Executive functions analysis showed deficits in working memory in five, mostly observed in Digits Indirect Order and Arithmetic tests (WISC III). Reading and writing skills were below the expected average for school grade in six patients according to the achievement scholar performance test utilized. One patient of this series who had the best scores in all tests was taking phenobarbital. CONCLUSIONS: Neuropsychological imbalance between normal IQ and mild dysfunctions such as in attention domain and in some executive abilities like working memory and planning, as well as difficulties in visual memory and in reading and writing, were described in this group of patients with BFSA from community. This may reflect mild higher level neurological dysfunctions in adolescence idiopathic focal seizures probably caused by an underlying dysmaturative epileptogenic process. Although academic problems often have multiple causes, a specific educational approach may be necessary in these adolescents, in order to improve their scholastic achievements, helping in this way, to decrease the stigma associated to epileptic seizures in the community.
Resumo:
Ferruginous "campos rupestres" are a particular type of vegetation growing on iron-rich primary soils. We investigated the influence of soil properties on plant species abundance at two sites of ferruginous "campos rupestres" and one site of quartzitic "campo rupestre", all of them in "Quadrilátero Ferrífero", in Minas Gerais State, southeastern Brazil. In each site, 30 quadrats were sampled to assess plant species composition and abundance, and soil samples were taken to perform chemical and physical analyses. The analyzed soils are strongly acidic and presented low fertility and high levels of metallic cations; a principal component analysis of soil data showed a clear segregation among sites due mainly to fertility and heavy metals content, especially Cu, Zn, and Pb. The canonical correspondence analysis indicated a strong correlation between plant species abundance and soil properties, also segregating the sites.
Resumo:
Secondary forests and exotic tree plantations are expanding across tropical landscapes. However, our current understanding of the value of these human-dominated forest landscapes for invertebrate biodiversity conservation is still very poor. In this paper, we use the leaf-litter ant fauna to assess invertebrate diversity in one commercially managed Eucalyptus plantation (four years old), two abandoned plantations of different regeneration ages (16 and 31 years), and one neighboring secondary Atlantic Forest in Southeastern Brazil. There was a clear gradient in species richness from the secondary forest to the managed Eucalyptus plantation; richness and diversity peaked in secondary forest and in the older regenerating Eucalyptus plantation. Significantly more species were recorded in secondary forest samples than in Eucalyptus plantations, but Eucalyptus plantations had a similar level of richness. Furthermore, a non-metric multidimensional scaling analysis revealed clear differences in species composition between the younger managed Eucalyptus plantation (understory absent) and habitats with sub-developed or developed understory. Eucalyptus plantations were characterized by an assemblage of widespread, generalist species very different from those known to occur in core forest habitats of southeastern Brazil. Our results indicate that while older regenerating Eucalyptus plantations can provide habitat to facilitate the persistence of generalist ant species, it is unlikely to conserve most of the primary forest species, such as specialized predators, Dacetini predators, and nomadic species.
Resumo:
The mineralogical characterization through mineral quantification of Brazilian soils by X-ray diffraction data using the Rietveld Method is not common. A mineralogical quantification of an Acric Ferralsol from the Ponta Grossa region, state of Paraná, Brazil, was carried out using this Method with X-Ray Diffraction data to verify if this method was suitable for mineral quantification of a highly-weathered soil. The A, AB and B3 horizons were fractioned to separate the different particle sizes: clay, silt, fine sand (by Stokes Law) and coarse sand fractions (by sieving), with the procedure free of chemical treatments. X-ray Fluorescence, Inductively Coupled Plasma Atomic Emission Spectrometry, Infrared Spectroscopy and Mössbauer Spectroscopy were used in order to assist the mineral identification and quantification. The Rietveld Method enabled the quantification of the present minerals. In a general way, the quantitative mineralogical characterization by the Rietveld Method revealed that quartz, gibbsite, rutile, hematite, goethite, kaolinite and halloysite were present in the clay and silt fractions of all horizons. The silt fractions of the deeper horizons were different from the more superficial ones due to the presence of large amounts of quartz. The fine and the coarse sand fractions are constituted mainly by quartz. Therefore, a mineralogical quantification of the finer fraction (clay and silt) by the Rietveld Method was successful.
Resumo:
The potential of charcoal and of partially combusted organic waste to mimic the soil organic matter of the Terras Pretas de Índios (Amazonian Dark Earths) from the Amazon Region is discussed. These materials serve as soil conditioners and as sequesterers of carbon in recalcitrant and in reactive forms. Studies carried out by Brazilian and by international groups have contributed to the emergence of an awareness of the compositions and of the uses of these materials. In this contribution we report on chemical studies that are leading to the development of a scientific and technological awareness, and of innovations that will have value in finding novel uses in applications to soil of chars from organic wastes such as those from the biofuel industry, and from metallurgical and various coal plant residues.
Resumo:
The aim of this study was to determine how abiotic factors drive the phytoplankton community in a water supply reservoir within short sampling intervals. Samples were collected at the subsurface (0.1 m) and bottom of limnetic (8 m) and littoral (2 m) zones in both the dry and rainy seasons. The following abiotic variables were analyzed: water temperature, dissolved oxygen, electrical conductivity, total dissolved solids, turbidity, pH, total nitrogen, nitrite, nitrate, total phosphorus, total dissolved phosphorus and orthophosphate. Phytoplankton biomass was determined from biovolume values. The role abiotic variables play in the dynamics of phytoplankton species was determined by means of Canonical Correspondence Analysis. Algae biomass ranged from 1.17×10(4) to 9.21×10(4) µg.L-1; cyanobacteria had biomass values ranging from 1.07×10(4) to 8.21×10(4) µg.L-1. High availability of phosphorous, nitrogen limitation, alkaline pH and thermal stability all favored cyanobacteria blooms, particularly during the dry season. Temperature, pH, total phosphorous and turbidity were key factors in characterizing the phytoplankton community between sampling times and stations. Of the species studied, Cylindrospermopsis raciborskii populations were dominant in the phytoplankton in both the dry and rainy seasons. We conclude that the phytoplankton was strongly influenced by abiotic variables, particularly in relation to seasonal distribution patterns.