871 resultados para Data detection
Resumo:
To assess the completeness and reliability of the Information System on Live Births (Sinasc) data. A cross-sectional analysis of the reliability and completeness of Sinasc's data was performed using a sample of Live Birth Certificate (LBC) from 2009, related to births from Campinas, Southeast Brazil. For data analysis, hospitals were grouped according to category of service (Unified National Health System, private or both), 600 LBCs were randomly selected and the data were collected in LBC-copies through mothers and newborns' hospital records and by telephone interviews. The completeness of LBCs was evaluated, calculating the percentage of blank fields, and the LBCs agreement comparing the originals with the copies was evaluated by Kappa and intraclass correlation coefficients. The percentage of completeness of LBCs ranged from 99.8%-100%. For the most items, the agreement was excellent. However, the agreement was acceptable for marital status, maternal education and newborn infants' race/color, low for prenatal visits and presence of birth defects, and very low for the number of deceased children. The results showed that the municipality Sinasc is reliable for most of the studied variables. Investments in training of the professionals are suggested in an attempt to improve system capacity to support planning and implementation of health activities for the benefit of maternal and child population.
Resumo:
Often in biomedical research, we deal with continuous (clustered) proportion responses ranging between zero and one quantifying the disease status of the cluster units. Interestingly, the study population might also consist of relatively disease-free as well as highly diseased subjects, contributing to proportion values in the interval [0, 1]. Regression on a variety of parametric densities with support lying in (0, 1), such as beta regression, can assess important covariate effects. However, they are deemed inappropriate due to the presence of zeros and/or ones. To evade this, we introduce a class of general proportion density, and further augment the probabilities of zero and one to this general proportion density, controlling for the clustering. Our approach is Bayesian and presents a computationally convenient framework amenable to available freeware. Bayesian case-deletion influence diagnostics based on q-divergence measures are automatic from the Markov chain Monte Carlo output. The methodology is illustrated using both simulation studies and application to a real dataset from a clinical periodontology study.
Resumo:
Patients with obstructive sleep apnea syndrome usually present with changes in upper airway morphology and/or body fat distribution, which may occur throughout life and increase the severity of obstructive sleep apnea syndrome with age. To correlate cephalometric and anthropometric measures with obstructive sleep apnea syndrome severity in different age groups. A retrospective study of cephalometric and anthropometric measures of 102 patients with obstructive sleep apnea syndrome was analyzed. Patients were divided into three age groups (≥20 and <40 years, ≥40 and <60 years, and ≥60 years). Pearson's correlation was performed for these measures with the apnea-hypopnea index in the full sample, and subsequently by age group. The cephalometric measures MP-H (distance between the mandibular plane and the hyoid bone) and PNS-P (distance between the posterior nasal spine and the tip of the soft palate) and the neck and waist circumferences showed a statistically significant correlation with apnea-hypopnea index in both the full sample and in the ≥40 and <60 years age group. These variables did not show any significant correlation with the other two age groups (<40 and ≥60 years). Cephalometric measurements MP-H and PNS-P and cervical and waist circumferences correlated with obstructive sleep apnea syndrome severity in patients in the ≥40 and <60 age group.
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
Low bone mineral density (BMD) has been found in human immunodeficiency virus (HIV)-infected patients; however, data on associated factors remain unclear, specifically in middle-aged women. This study aims to evaluate factors associated with low BMD in HIV-positive women. In this cross-sectional study, a questionnaire was administered to 206 HIV-positive women aged 40 to 60 years who were receiving outpatient care. Clinical features, laboratory test results, and BMD were assessed. Yates and Pearson χ(2) tests and Poisson multiple regression analysis were performed. The median age of women was 47.7 years; 75% had nadir CD4 T-cell counts higher than 200, and 77.8% had viral loads below the detection limit. There was no association between low BMD at the proximal femur and lumbar spine (L1-L4) and risk factors associated with HIV infection and highly active antiretroviral therapy. Poisson multiple regression analysis showed that the only factor associated with low BMD at the proximal femur and lumbar spine was postmenopause status. Low BMD is present in more than one third of this population sample, in which most women are using highly active antiretroviral therapy and have a well-controlled disease. The main associated factor is related to estrogen deprivation. The present data support periodic BMD assessments in HIV-infected patients and highlight the need to implement comprehensive menopausal care for these women to prevent bone loss.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
The syndrome of resistance to thyroid hormone (RTH β) is an inherited disorder characterized by variable tissue hyposensitivity to 3,5,30-l-triiodothyronine (T3), with persistent elevation of free-circulating T3 (FT3) and free thyroxine (FT4) levels in association with nonsuppressed serum thyrotropin (TSH). Clinical presentation is variable and the molecular analysis of THRB gene provides a short cut diagnosis. Here, we describe 2 cases in which RTH β was suspected on the basis of laboratory findings. The diagnosis was confirmed by direct THRB sequencing that revealed 2 novel mutations: the heterozygous p.Ala317Ser in subject 1 and the heterozygous p.Arg438Pro in subject 2. Both mutations were shown to be deleterious by SIFT, PolyPhen, and Align GV-GD predictive methods.
Resumo:
The caffeine solubility in supercritical CO2 was studied by assessing the effects of pressure and temperature on the extraction of green coffee oil (GCO). The Peng-Robinson¹ equation of state was used to correlate the solubility of caffeine with a thermodynamic model and two mixing rules were evaluated: the classical mixing rule of van der Waals with two adjustable parameters (PR-VDW) and a density dependent one, proposed by Mohamed and Holder² with two (PR-MH, two parameters adjusted to the attractive term) and three (PR-MH3 two parameters adjusted to the attractive and one to the repulsive term) adjustable parameters. The best results were obtained with the mixing rule of Mohamed and Holder² with three parameters.
Resumo:
A method to quantify lycopene and β-carotene in freeze dried tomato pulp by high performance liquid chromatography (HLPC) was validated according to the criteria of selectivity, sensitivity, precision and accuracy, and uncertainty estimation of measurement was determined with data obtained in the validation. The validated method presented is selective in terms of analysis, and it had a good precision and accuracy. Detection limit for lycopene and β-carotene was 4.2 and 0.23 mg 100 g-1, respectively. The estimation of expanded uncertainty (K = 2) for lycopene was 104 ± 21 mg 100 g-1 and for β-carotene was 6.4 ± 1.5 mg 100 g-1.
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
cDNA arrays are a powerful tool for discovering gene expression patterns. Nylon arrays have the advantage that they can be re-used several times. A key issue in high throughput gene expression analysis is sensitivity. In the case of nylon arrays, signal detection can be affected by the plastic bags used to keep membranes humid. In this study, we evaluated the effect of five types of plastics on the radioactive transmittance, number of genes with a signal above the background, and data variability. A polyethylene plastic bag 69 μm thick had a strong shielding effect that blocked 68.7% of the radioactive signal. The shielding effect on transmittance decreased the number of detected genes and increased the data variability. Other plastics which were thinner gave better results. Although plastics made from polyvinylidene chloride, polyvinyl chloride (both 13 μm thick) and polyethylene (29 and 7 μm thick) showed different levels of transmittance, they all gave similarly good performances. Polyvinylidene chloride and polyethylene 29 mm thick were the plastics of choice because of their easy handling. For other types of plastics, it is advisable to run a simple check on their performance in order to obtain the maximum information from nylon cDNA arrays.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
OBJECTIVE: To characterize the behavior of premature newborns in the first year of chronological age. METHODS: This is a cross-sectional descriptive study, bound to a longitudinal study titled: Comparison of visual behavior on the first quarter of year of life of premature nursling born at two maternities of Recife/PE. The sample was composed by 52 premature newborns selected from June, 2007 to June, 2008 from the Maternity of the Federal University of Pernambuco (UFPE). Biological, socioeconomic and demographic data was collected through medical records and interviews with progeny. Newborns were evaluated by the Assessment Guide of Visual Ability in Infants. RESULTS: Most of the newborns were male at a gestational period between 33 weeks and 36 weeks and 6 days, showed a good visual behavior development for the age researched, and most of the families showed good socioeconomical and demographic profile. Besides, it was possible to detect ocular signs in 19% of sample, that were referred to an Ophthalmology Service. CONCLUSION: This study results point out the method like an important key in the early detection and visual screening for premature nursling since the first month of life and it led us to believe that clinical view for occupational therapy intervention must be focused not only on biological risks but also at the influence environment in newborn performance.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física