Lawsonia Inermis-mediated Synthesis Of Silver Nanoparticles: Activity Against Human Pathogenic Fungi And Bacteria With Special Reference To Formulation Of An Antimicrobial Nanogel.

Lawsonia inermis mediated synthesis of silver nanoparticles (Ag-NPs) and its efficacy against Candida albicans, Microsporum canis, Propioniabacterium acne and Trichophyton mentagrophytes is reported. A two-step mechanism has been proposed for bioreduction and formation of an intermediate complex leading to the synthesis of capped nanoparticles was developed. In addition, antimicrobial gel for M. canis and T. mentagrophytes was also formulated. Ag-NPs were synthesized by challenging the leaft extract of L. inermis with 1 mM AgNO₃. The Ag-NPs were characterized by Ultraviolet-Visible (UV-Vis) spectrophotometer and Fourier transform infrared spectroscopy (FTIR). Transmission electron microscopy (TEM), nanoparticle tracking and analysis sytem (NTA) and zeta potential was measured to detect the size of Ag-NPs. The antimicrobial activity of Ag-NPs was evaluated by disc diffusion method against the test organisms. Thus these Ag-NPs may prove as a better candidate drug due to their biogenic nature. Moreover, Ag-NPs may be an answer to the drug-resistant microorganisms.

Evaluation Of The Cytotoxicity And Phototoxicity Of Caryocar Brasiliense Supercritical Carbon Dioxide Extract.

Caryocar brasiliense Camb (Pequi) is a typical Brazilian Cerrado fruit tree. Its fruit is used as a vitamin source for culinary purposes and as a source of oil for the manufacture of cosmetics. C. brasiliense supercritical CO2 extracts exhibit antimicrobial activity against the bacteria Escherichia coli, Pseudomonas aeruginosa, and Staphylococcus aureus and also possess antioxidant activity. This study was designed to evaluate the in vitro cytotoxicity and phototoxicity of the supercritical CO2 extract obtained from the leaves of this species. In vitro cytotoxicity and phototoxicity of C. brasiliense supercritical CO2 extracts were assessed using a tetrazolium-based colorimetric assay (XTT) and Neutral Red methods. We found that the C. brasiliense (Pequi) extract obtained by supercritical CO2 extraction did not present cytotoxic and phototoxic hazards. This finding suggests that the extract may be useful for the development of cosmetic and/or pharmaceutical products.

Inhibition Of Tumor Necrosis Factor-alpha And Cyclooxigenase-2 By Isatin: A Molecular Mechanism Of Protection Against Tnbs-induced Colitis In Rats.

Isatin, an indole alkaloid has been shown to have anti-microbial, anti-tumor and anti-inflammatory effects. Due to its findings, we evaluated whether this alkaloid would have any effect on TNBS-induced colitis. Animals (male Unib:WH rats, aged 8 weeks old) were induced colitis through a rectal administration of 2,4,6-trinitrobenzene sulphonic acid using a catheter inserted 8 cm into the rectum of the animals. The rats were divided into two major groups: non-colitic and colitic. The colitic group was sub-divided into 6 groups (10 animals per group): colitic non-treated, Isatin 3; 6; 12.5; 18.75 and 25 mg/kg. Our main results showed that the oral treatment with Isatin 6 and 25 mg/kg were capable of avoiding the increase in TNF-α, COX-2 and PGE₂ levels when compared to the colitic non-treated group. Interestingly, the same doses (6 and 25 mg/kg) were also capable of preventing the decrease in IL-10 levels comparing with the colitic non-treated group. The levels of MPO, (an indirect indicator of neutrophil presence), were also maintained lower than those of the colitic non-treated group. Isatin also prevented the decrease of SOD activity and increase of GSH-Px and GSH-Rd activity as well as the depletion of GSH levels. In conclusion, both pre-treatments (6 and 25 mg/kg) were capable of protecting the gut mucosa against the injury caused by TNBS, through the combination of antioxidant and anti-inflammatory properties, which, together, showed a protective activity of the indole alkaloid Isatin.

In Vitro Biological Screening Of The Anticholinesterase And Antiproliferative Activities Of Medicinal Plants Belonging To Annonaceae.

The aim of this research was to investigate the antiproliferative and anticholinesterase activities of 11 extracts from 5 Annonaceae species in vitro. Antiproliferative activity was assessed using 10 human cancer cell lines. Thin-layer chromatography and a microplate assay were used to screen the extracts for acetylcholinesterase (AchE) inhibitors using Ellman's reagent. The chemical compositions of the active extracts were investigated using high performance liquid chromatography. Eleven extracts obtained from five Annonaceae plant species were active and were particularly effective against the UA251, NCI-470 lung, HT-29, NCI/ADR, and K-562 cell lines with growth inhibition (GI50) values of 0.04-0.06, 0.02-0.50, 0.01-0.12, 0.10-0.27, and 0.02-0.04 µg/mL, respectively. In addition, the Annona crassiflora and A. coriacea seed extracts were the most active among the tested extracts and the most effective against the tumor cell lines, with GI50 values below 8.90 µg/mL. The A. cacans extract displayed the lowest activity. Based on the microplate assay, the percent AchE inhibition of the extracts ranged from 12 to 52%, and the A. coriacea seed extract resulted in the greatest inhibition (52%). Caffeic acid, sinapic acid, and rutin were present at higher concentrations in the A. crassiflora seed samples. The A. coriacea seeds contained ferulic and sinapic acid. Overall, the results indicated that A. crassiflora and A. coriacea extracts have antiproliferative and anticholinesterase properties, which opens up new possibilities for alternative pharmacotherapy drugs.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

O ensino do esporte paralímpico na escola a partir da visão dos professores : o caso do Goolball e do voleibol sentado = The teaching paralympic sport at school from teacher's perspective : the case of Goalball and sitting volleyball

Universidade Estadual de Campinas . Faculdade de Educação Física

Pimarane-type Diterpenes: Antimicrobial Activity against Oral Pathogens

Seven pimarane type-diterpenes re-isolated from Viguiera arenaria Baker and two semi-synthetic pimarane derivatives were evaluated in vitro against the following main microorganisms responsible for dental caries: Streptococcus salivarius, S. sobrinus, S. mutans, S. mitis, S. sanguinis and Lactobacillus casei. The compounds ent-pimara-8(14), 15-dien-19-oic acid (PA); ent-8(14), 15-pimaradien-3 beta-ol; ent-15-pimarene-8 beta, 19-diol; ent-8(14), 15-pimaradien-3 beta-acetoxy and the sodium salt derivative of PA were the most active compounds, displaying MIC values ranging from 2 to 8 mu g.mL(-1). Thus, this class of compounds seems promising as a class of new effective anticariogenic agents. Furthermore, our results also allow us to conclude that minor structural differences among these diterpenes significantly influence their antimicrobial activity, bringing new perspectives to the discovery of new natural compounds that could be employed in the development of oral care products.

Antileishmanial Activity of the Hydroalcoholic Extract of Miconia langsdorffii, Isolated Compounds, and Semi-Synthetic Derivatives

The in vitro activity of the crude hydroalcoholic extract of the aerial parts of Miconia langsdorffii Cogn. was evaluated against the promastigote forms of L. amazonensis, the causative agent of cutaneous leishmaniasis in humans. The bioassay-guided fractionation of this extract led to identification of the triterpenes ursolic acid and oleanolic acid as the major compounds in the fraction that displayed the highest activity. Several ursolic acid semi-synthetic derivatives were prepared, to find out whether more active compounds could be obtained. Among these ursolic acid-derived substances, the C-28 methyl ester derivative exhibited the best antileishmanial activity.

Unexpected Diversity of Cellular Immune Responses against Nef and Vif in HIV-1-Infected Patients Who Spontaneously Control Viral Replication

Background: HIV-1-infected individuals who spontaneously control viral replication represent an example of successful containment of the AIDS virus. Understanding the anti-viral immune responses in these individuals may help in vaccine design. However, immune responses against HIV-1 are normally analyzed using HIV-1 consensus B 15-mers that overlap by 11 amino acids. Unfortunately, this method may underestimate the real breadth of the cellular immune responses against the autologous sequence of the infecting virus. Methodology and Principal Findings: Here we compared cellular immune responses against nef and vif-encoded consensus B 15-mer peptides to responses against HLA class I-predicted minimal optimal epitopes from consensus B and autologous sequences in six patients who have controlled HIV-1 replication. Interestingly, our analysis revealed that three of our patients had broader cellular immune responses against HLA class I-predicted minimal optimal epitopes from either autologous viruses or from the HIV-1 consensus B sequence, when compared to responses against the 15-mer HIV-1 type B consensus peptides. Conclusion and Significance: This suggests that the cellular immune responses against HIV-1 in controller patients may be broader than we had previously anticipated.

Expression and cellular localization of microRNA-29b and RAX, an activator of the RNA-dependent protein kinase (PKR), in the retina of streptozotocin-induced diabetic rats

Purpose: The apoptosis of retinal neurons plays a critical role in the pathogenesis of diabetic retinopathy (DR), but the molecular mechanisms underlying this phenomenon remain unclear. The purpose of this study was to investigate the cellular localization and the expression of microRNA-29b (miR-29b) and its potential target PKR associated protein X (RAX), an activator of the pro-apoptotic RNA-dependent protein kinase (PKR) signaling pathway, in the retina of normal and diabetic rats. Methods: Retinas were obtained from normal and diabetic rats within 35 days after streptozotocin (STZ) injection. In silico analysis indicated that RAX is a potential target of miR-29b. The cellular localization of miR-29b and RAX was assessed by in situ hybridization and immunofluorescence, respectively. The expression levels of miR-29b and RAX mRNA were evaluated by quantitative reverse transcription PCR (qRT-PCR), and the expression of RAX protein was evaluated by western blot. A luciferase reporter assay and inhibition of endogenous RAX were performed to confirm whether RAX is a direct target of miR-29b as predicted by the in silico analysis. Results: We found that miR-29b and RAX are localized in the retinal ganglion cells (RGCs) and the cells of the inner nuclear layer (INL) of the retinas from normal and diabetic rats. Thus, the expression of miR-29b and RAX, as assessed in the retina by quantitative RT-PCR, reflects their expression in the RGCs and the cells of the INL. We also revealed that RAX protein is upregulated (more than twofold) at 3, 6, 16, and 22 days and downregulated (70%) at 35 days, whereas miR-29b is upregulated (more than threefold) at 28 and 35 days after STZ injection. We did not confirm the computational prediction that RAX is a direct target of miR-29b. Conclusions: Our results suggest that RAX expression may be indirectly regulated by miR-29b, and the upregulation of this miRNA at the early stage of STZ-induced diabetes may have a protective effect against the apoptosis of RGCs and cells of the INL by the pro-apoptotic RNA-dependent protein kinase (PKR) signaling pathway.

Vaccination of Mice with Salmonella Expressing VapA: Mucosal and Systemic Th1 Responses Provide Protection against Rhodococcus equi Infection

Conventional vaccines to prevent the pneumonia caused by Rhodococcus equi have not been successful. We have recently demonstrated that immunization with Salmonella enterica Typhimurium expressing the VapA antigen protects mice against R. equi infection. We now report that oral vaccination of mice with this recombinant strain results in high and persistent fecal levels of antigen-specific IgA, and specific proliferation of the spleen cells of immunized mice in response to the in vitro stimulation with R. equi antigen. After in vitro stimulation, spleen cells of immunized mice produce high levels of Th1 cytokines and show a prominent mRNA expression of the Th1 transcription factor T-bet, in detriment of the Th2 transcription factor GATA-3. Following R. equi challenge, a high H(2)O(2), NO, IL-12, and IFN-gamma content is detected in the organs of immunized mice. On the other hand, TNF-alpha and IL-4 levels are markedly lower in the organs of vaccinated mice, compared with the non-vaccinated ones. The IL-10 content and the mRNA transcription level of TGF-beta are also higher in the organs of immunized mice. A greater incidence of CD4(+) and CD8(+) T cells and B lymphocytes is verified in vaccinated mice. However, there is no difference between vaccinated and non-vaccinated mice in terms of the frequency of CD4(+)CD25(+)Foxp3(+) T cells. Finally, we show that the vaccination confers a long-term protection against R. equi infection. Altogether, these data indicate that the oral vaccination of mice with S. enterica Typhimurium expressing VapA induces specific and long-lasting humoral and cellular responses against the pathogen, which are appropriately regulated and allow tissue integrity after challenge.

REVISITING THE FOSSIL GROUP CANDIDATES UGC 842 AND NGC 6034

We present a new insight on NGC 6034 and UGC 842, two groups of galaxies previously reported in the literature as being fossil groups. The study is based on optical photometry and spectroscopy obtained with the CTIO Blanco telescope and Sloan Digital Sky Survey archival data. We find that NGC 6034 is embedded in a large structure, dominated by three rich clusters and other small groups. Its first and next four ranked galaxies have magnitude differences in the r band and projected distances which violate the optical criteria to classify it as a fossil group. We confirm that the UGC 842 group is a fossil group, but with about half the velocity dispersion that is reported in previous works. The velocity distribution of its galaxies reveals the existence of two structures in its line of sight, one with sigma(nu) similar to 223 km s(-1) and another with sigma(nu) similar to 235 km s(-1), with a difference in velocity of similar to 820 km s(-1). The main structure is dominated by passive galaxies, while these represent similar to 60% of the second structure. The X-ray temperature for the intragroup medium of a group with such a velocity dispersion is expected to be kT similar to 0.5-1 keV, against the observed value of kT similar to 1.9 keV reported in the literature. This result makes UGC 842 a special case among fossil groups because (1) it represents more likely the interaction between two small groups, which warms the intragroup medium and/or (2) it could constitute evidence that member galaxies lost energy in the process of spiraling toward the group center, and decreased the velocity dispersion of the system. As far as we know, UGC 842 is the first low-mass fossil group studied in detail.

Endophytic and entomopathogenic strains of Beauveria sp to control the bovine tick Rhipicephalus (Boophilus) microplus

Pathogenicity of strains of the entomopathogenic fungus Beauveria bassiana and endophytic strains of Beauveria sp against the bovine tick Rhipicephalus (Boophilus) microplus was tested in laboratory bioassays and under field conditions. Suspensions containing 10(5), 10(7) and 10(9) conidia/mL were prepared of each fungal strain for laboratory bioassays. The ticks were maintained at 28 degrees C, 90 +/- 5% relative humidity, and the following variables were evaluated: initial female weight, egg weight, hatching percentage, reproductive efficiency, and percentage control. For tests under field conditions, a Beauveria suspension containing 10(6) conidia/mL was sprayed on tick-infested cows. After 72 h, the ticks were collected to estimate mortality under field conditions. Laboratory bioassays showed a mortality of 20 to 50% of the ticks seven days after inoculation with 10(7) Beauveria conidia/mL. Under field conditions 10(6) Beauveria conidia/mL induced 18-32% mortality. All Beauveria strains were effective in biological control of R. (Boophilus) microplus under laboratory and field test conditions. This is the first demonstration that endophytic fungi can be used for biological control of the cattle tick; this could help reduce environmental contamination by diminishing the need for chemical acaricides. Two endophytic strains were isolated from maize leaves and characterized by molecular sequencing of 5.8S rDNA ITS1 and ITS2 and morphological analyses of conidia. We found that these two endophytic Beauveria isolates, designated B95 and B157, are close to Beauveria amorpha.

Looking at the Gregory-Laflamme instability through quasinormal modes

We study evolution of gravitational perturbations of black strings. It is well known that for all wave numbers less than some threshold value, the black string is unstable against the scalar type of gravitational perturbations, which is named the Gregory-Laflamme instability. Using numerical methods, we find the quasinormal modes and time-domain profiles of the black string perturbations in the stable sector and also show the appearance of the Gregory-Laflamme instability in the time domain. The dependence of the black string quasinormal spectrum and late-time tails on such parameters as the wave vector and the number of extra dimensions is discussed. There is numerical evidence that at the threshold point of instability, the static solution of the wave equation is dominant. For wave numbers slightly larger than the threshold value, in the region of stability, we see tiny oscillations with very small damping rate. While, for wave numbers slightly smaller than the threshold value, in the region of the Gregory-Laflamme instability, we observe tiny oscillations with very small growth rate. We also find the level crossing of imaginary part of quasinormal modes between the fundamental mode and the first overtone mode, which accounts for the peculiar time domain profiles.

Limit on the diffuse flux of ultrahigh energy tau neutrinos with the surface detector of the Pierre Auger Observatory

Data collected at the Pierre Auger Observatory are used to establish an upper limit on the diffuse flux of tau neutrinos in the cosmic radiation. Earth-skimming nu(tau) may interact in the Earth's crust and produce a tau lepton by means of charged-current interactions. The tau lepton may emerge from the Earth and decay in the atmosphere to produce a nearly horizontal shower with a typical signature, a persistent electromagnetic component even at very large atmospheric depths. The search procedure to select events induced by tau decays against the background of normal showers induced by cosmic rays is described. The method used to compute the exposure for a detector continuously growing with time is detailed. Systematic uncertainties in the exposure from the detector, the analysis, and the involved physics are discussed. No tau neutrino candidates have been found. For neutrinos in the energy range 2x10(17) eV < E(nu)< 2x10(19) eV, assuming a diffuse spectrum of the form E(nu)(-2), data collected between 1 January 2004 and 30 April 2008 yield a 90% confidence-level upper limit of E(nu)(2)dN(nu tau)/dE(nu)< 9x10(-8) GeV cm(-2) s(-1) sr(-1).