Ecomateriais: desenvolvimento e aplicação de materiais porosos funcionais para proteção ambiental

Fundamental aspects of the conception and applications of ecomaterials, in particular porous materials in the perspective of green chemistry are discussed in this paper. General recommendations for description and classification of porous materials are reviewed briefly. By way of illustration, some case studies of materials design and applications in pollution detection and remediation are described. It is shown here how different materials developed by our groups, such as porous glasses, ecomaterials from biomass and anionic clays were programmed to perform specific functions. A discussion of the present and future of ecomaterials in green chemistry is presented along with important key goals.

Desenvolvimento e caracterização de nanocápsulas de poli (L-lactídeo) contendo benzocaína

In this paper we describe the preparation poly (L-lactide) (PLA) nanocapsules as a drug delivery system for the local anesthetic benzocaine. The characterization and in vitro release properties of the system were investigated. The characterization results showed a polydispersity index of 0.14, an average diameter of 190.1± 3 nm, zeta potential of -38.5 mV and an entrapment efficiency of 73%. The release profile of Benzocaine loaded in PLA nanocapsules showed a significant different behavior than that of the pure anesthetic in solution. This study is important to characterize a drug release system using benzocaine for application in pain treatment.

Desenvolvimento de um algoritmo para identificação e correção de spikes em espectroscopia Raman de imagem

Raman imaging spectroscopy is a highly useful analytical tool that provides spatial and spectral information on a sample. However, CCD detectors used in dispersive instruments present the drawback of being sensitive to cosmic rays, giving rise to spikes in Raman spectra. Spikes influence variance structures and must be removed prior to the use of multivariate techniques. A new algorithm for correction of spikes in Raman imaging was developed using an approach based on comparison of nearest neighbor pixels. The algorithm showed characteristics including simplicity, rapidity, selectivity and high quality in spike removal from hyperspectral images.

Desenvolvimento, produção e caracterização de nanocristais de fármacos pouco solúveis

Poorly soluble drugs have low bioavailability, representing a major challenge for the pharmaceutical industry. Processing drugs into the nanosized range changes their physical properties, and these are being used in pharmaceutics to develop innovative formulations known as Nanocrystals. Use of nanocrystals to overcome the problem of low bioavailability, and their production using different techniques such as microfluidization or high pressure homogenization, was reviewed in this paper. Examples of drugs, cosmetics and nutraceutical ingredients were also discussed. These technologies are well established in the pharmaceutical industry and are approved by the Food and Drug Administration.

Desenvolvimento e validação de método espectrofotométrico para determinação de corante à base de luteína adicionado em iogurte desnatado

A simple analytical method for extraction and quantification of lutein colorant added to yogurt was developed and validated. The method allowed complete extraction of carotenoids using tetrahydrofuran in vortex, followed by centrifugation, partition to diethyl ether/petroleum ether, and drying. The carotenoids dissolved in ethanol were quantified by UV-Vis spectrophotometry. This method showed linearity in the range tested (1.41-13.42 µg g-1), limits of detection and quantification of 0.42 and 1.28 µg g-1, respectively, low relative standard deviation (3.4%) and recovery ranging from 95 to 103%. The method proved reliable for quantification of lutein added to yogurt.

Desenvolvimento e avaliação de uma servoválvula de baixo custo para a aplicação de insumos líquidos

The present work aimed the development of a low cost servo-valve that answers to an electronic control signal, for variable rates liquid inputs application. A literature research to define which valve type should be used was made. A mechanically activated proportional valve with an electronically controlled servo-engine was designed and evaluated. Since developed the servo-valve, the system was submited to a number of tests .The evaluation of its behavior was obtained in terms of repeatability, hystheresis and linearity. The test was accomplished in a bench, specially developed for this aim. As a result, were obtained three curves of opening percentage as function of flow rate, describing three opening and closing increments in two different work pressures. The servo-valve presented a good repeatability, reasonable hysteresis and a typically quadratic curve. This one maintained the low cost target. These results were very satisfied because the non-linearity and the hysteresis could be easily corrected by software.

Mapeamento de semeaduras de soja (Glycine max (L.)Merr.) mediante dados MODIS/Terra E TM/Landsat 5: um comparativo

The objective of this work was to compare the soybean crop mapping in the western of Parana State by MODIS/Terra and TM/Landsat 5 images. Firstly, it was generated a soybean crop mask using six TM images covering the crop season, which was used as a reference. The images were submitted to Parallelepiped and Maximum Likelihood digital classification algorithms, followed by visual inspection. Four MODIS images, covering the vegetative peak, were classified using the Parallelepiped method. The quality assessment of MODIS and TM classification was carried out through an Error Matrix, considering 100 sample points between soybean or not soybean, randomly allocated in each of the eight municipalities within the study area. The results showed that both the Overall Classification (OC) and the Kappa Index (KI) have produced values ranging from 0.55 to 0.80, considered good to very good performances, either in TM or MODIS images. When OC and KI, from both sensors were compared, it wasn't found no statistical difference between them. The soybean mapping, using MODIS, has produced 70% of reliance in terms of users. The main conclusion is that the mapping of soybean by MODIS is feasible, with the advantage to have better temporal resolution than Landsat, and to be available on the internet, free of charge.

Produção de alface hidropônica em três ambientes de cultivo

It was proposed to evaluate the hydroponic lettuce production, variety Vera, on inclined benches with channels of 100 mm, and Nutrient Film Technique, as answer to carbon dioxide application and evaporative cooling. There were five cycles of cultivation from March, 20th to April, 17th (C1); from May, 25th to June, 29th (C2); from July, 13th to August, 20th (C3); from August, 27th to October, 10th (C4); from December, 12th to January, 10th (C5). In three greenhouses were tested the following systems: (A1) without evaporative cooling air CO2 aerial injection, (A2) with CO2 aerial injection and without evaporative cooling and (A3) with CO2 aerial injection and pad-fan evaporative cooling system. The fresh and dry mass of leaves in grams, number of leaves and leaf area in square millimeter were evaluated. The completely randomized statistical analysis was used. The cycle C1 were used 48 replications, for cycles C2, C3 and C5 were used 64 replications and C5 were used 24 replications. The results showed that greenhouse with evaporative cooling system and CO2 allow better development and greater lettuce yield. It was possible to conclude that the aerial injection of CO2, in the absence of evaporative cooling system, did not lead increasing the lettuce productivity to most cycles. Bigger lettuce leaf areas were found in periods with higher temperatures.

Germinação e crescimento de Calophyllum brasiliense (Clusiaceae), uma espécie típica de florestas inundadas

Soil waterlogging and the subsequent reduction in the amount of oxygen available for the respiration of the root system selected, along the evolutive process, plants able to thrive in seasonally or permanently flooded areas. In neotropical plants there are many types of adaptations to flooding. In this paper we present the results of the work carried out with seeds and seedlings of C brasiliense subjected to hypoxia during germination and early development. C brasiliense seeds are not photoblastic and survive up to three months burried in a water saturated substrate, but germination only takes place in well-drained soils. Soil waterlogging does not inhibit seedling growth and there are no apparent morphological changes of the aerial part of flooded plants. New and aerated roots that make plant survival possible replace old and spoiled roots. In contrast to many typical species of flood-prone areas where growth is inhibited by oxygen stress. C. brasiliense seedlings seem to be well adapted to their waterlogged environment. Seed dispersion, the absence of photoblastic response as well as seed and seedling capacity of surviving and growing in waterlogged soils contribute to the wide geographic distribution of C. brasiliense always associated with areas subjected to soil waterlogging.

Formação das substâncias de reserva durante o desenvolvimento de sementes de urucum (Bixa orellana L. - Bixaceae)

Annatto seeds do not germinate during early stages of their development because of insufficient reserve substances. In situ analysis showed that the principal reserves are proteins and starch, deposited in endosperm cells. During the early stages of development, the starch grains were elliptic, because amylose was the minor component. During development, these grains became more spherical due to an increase in amylose relative to amylopectin. Endosperm cells do not contain protein bodies, but they accumulate proteins dispersed in the cytoplasm. At the final stage of development the proteins became compacted due to the dehydration of the seeds wich is part of the global process of orthodox seeds maturation. Natural fluorescence revealed aromatic amino acids, principally tryptophan and tyrosine in the proteins. The seeds reached their maximum dry weight after moisture contents had declined to around 60%. At this point the seeds presented maximum germination capacity.

Efeito da temperatura e do teor de umidade na iniciação e desenvolvimento do rizoma de Kohleria eriantha (Benth.) Hanst. (Gesneriaceae)

Kohleria eriantha (Benth.) Hanst is a plant belonging to the family Gesneriaceae, with an underground organ, which is associated with vegetative reproduction. This organ is a rhizome, whose stem bears buds covered with modified leaves that store up starch. In small sections of this rhizome, containing six buds (1.5 to 2.0cm long), only one bud sprouted. The sprouted bud could be differentiated into two morphological pattern: aerial part or rhizome. Sprouting of the rhizome pattern occurred in sections kept on substrate with low water content (1mL of water), or lacking water, whereas sprouting of the aerial part pattern occurred in sections on substrate with high water content (12mL of water). Temperature at 20ºC also stimulated sprouting of the rhizome pattern, regardless of the water volume in the substrate. Sprouting of the rhizome pattern occurred still in sections on substrate to which polyethylene glycol 6000 (PEG) solution was added at the concentrations of 161.2, 235.2 and 340.0g/L, resulting in potentials of -3, -6 and -12 MPa, respectively. Sections kept on substrate with low water content (1 ml of water) showed a reduction in the dry matter content and high osmotic concentration in comparison with those on substrate with high water content. The results obtained revealed that forming of the rhizome pattern was influenced by water content and temperature. It is suggested that sprouting of the rhizome pattern was induced by the low water potential in the sections, when kept on substrate with low water content. Moreover, it was observed that the rhizome buds of Kohleria eriantha showed a high degree of plasticity.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparação entre diferentes ciclo simuladores e ciclismo em velódromo : testes de desempenho máximo de 5 quilômetros

Universidade Estadual de Campinas . Faculdade de Educação Física

O panorama da ginastica artistica masculina brasileira : um estudo historico-critico do periodo 2005-2008

Universidade Estadual de Campinas . Faculdade de Educação Física

Desenvolvimento de equações generalizadas para estimativa da coordenação motora em crianças e adolescentes portadores de deficiencia mental

Universidade Estadual de Campinas . Faculdade de Educação Física