O papel da interação no processo de ensino-aprendizagem de português para alunos surdos em uma escola inclusiva

In this article, it is discussed the role of interaction in the process of teaching and learning Portuguese of deaf students at an inclusive school. In the context where the research took place, the hearing teacher does not understand sign language, and there are, in her classroom, hearing students and four deaf students, being three of them sign language users. As the communication between the hearing teacher and the deaf students occurred in different codes - Portuguese and Brazilian sign language - and having a social-interactional approach of language (MOITA LOPES, 1986; FREIRE, 1999), we observed if the interaction among the subjects enabled the deaf students to understand what was being taught. The results showed that the fact of having four deaf students in the same classroom allowed them to work in a cooperative way. Besides, the sign language became more visible in this institution. On the other hand, the interaction between the teacher and her deaf students revealed to be of little significance to the learning process of this small group.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Efeitos de diferentes protocolos de treinamento físico sobre o controle autonômico e cardiorrespiratório em homens de meia-idade

Universidade Estadual de Campinas . Faculdade de Educação Física

O esporte paraolímpico no Brasil : abordagem da sociologia do esporte de Pierre Bourdieu

Universidade Estadual de Campinas . Faculdade de Educação Física

Auto-eficácia docente e motivação para a realização do(a) professor(a) de Educação Física Adaptada

Universidade Estadual de Campinas . Faculdade de Educação Física

Sistema de análise de movimento para avaliação da postura vertical durante a corrida no teste de esforço máximo incremental

Universidade Estadual de Campinas . Faculdade de Educação Física

Metodos de avaliação em Educação Fisica no ensino fundamental

Universidade Estadual de Campinas . Faculdade de Educação Física

As aulas de educação fisica escolar : uma analise do processo inclusivo

Universidade Estadual de Campinas. Faculdade de Educação Física

Pedagogia do esporte : identificação, discussão e aplicação de procedimentos pedagogicos no processo de ensino-vivencia aprendizagem da modalidade basquetebol

Universidade Estadual de Campinas . Faculdade de Educação Física

Analise do processo de rastreamento automatico de jogadores em esportes coletivos

Universidade Estadual de Campinas . Faculdade de Educação Física

As manifestações da emoção vivida no processo de aprendizagem da educação fisica escolar : totalidade ininterrupta de troca e construção de experiencias humanas

Universidade Estadual de Campinas . Faculdade de Educação Física

O papel da propriocepção no desenvolvimento da força muscular e da flexibilidade

Universidade Estadual de Campinas . Faculdade de Educação Física

Psicoterapia dinamica breve : uma intervenção alternativa na preparação psicologica de tenistas infanto-juvenis

Universidade Estadual de Campinas. Faculdade de Educação Física

Atividade fisica e os dominios da qualidade de vida e do autoconceito no processo de envelhecimento

Universidade Estadual de Campinas . Faculdade de Educação Fisica

Clown, processo criativo : rito de iniciação e passagem

Universidade Estadual de Campinas . Faculdade de Educação Física