950 resultados para Control applications
Resumo:
Objective Patients with mesial temporal lobe epilepsy (MTLE) may present unstable pattern of seizures. We aimed to evaluate the occurrence of relapse-remitting seizures in MTLE with (MTLE-HS) and without (MTLE-NL) hippocampal sclerosis. Method We evaluated 172 patients with MTLE-HS (122) or MTLE-NL (50). Relapse-remitting pattern was defined as periods longer than two years of seizure-freedom intercalated with seizure recurrence. Infrequent seizures was considered as up to three seizures per year and frequent seizures as any period of seizures higher than that. Results Thirty-seven (30%) MTLE-HS and 18 (36%) MTLE-NL patients had relapse-remitting pattern (X2, p = 0.470). This was more common in those with infrequent seizures (X2, p < 0.001). Twelve MTLE-HS and one MTLE-NL patients had prolonged seizure remission between the first and second decade of life (X2, p = 0.06). Conclusion Similar proportion of MTLE-HS or MTLE-NL patients present relapse-remitting seizures and this occurs more often in those with infrequent seizures.
Resumo:
In recent years, the scientific community has undertaken research on plant extracts, searching for compounds with pharmacological activities that can be used in diverse fields of medicine. Calendula officinalis L. is known to have antioxidant, anti-inflammatory, antibacterial, and wound healing properties when used to treat skin burns. Therefore, the purpose of this study was to analyze the effects of C. officinalis on the initial phase of Achilles tendon healing. Wistar rats were separated in three groups: Calendula (Cal)-rats with a transected tendon were treated with topical applications of C. officinalis cream and then euthanized 7 days after injury; Control (C)-rats were treated with only vehicle after transection; and Normal (N)-rats without tenotomy. Higher concentrations of hydroxyproline (an indicator of total collagen) and non-collagenous proteins were observed in the Cal group in relation to the C group. Zymography showed no difference in the amount of the isoforms of metalloproteinase-2 and of metalloproteinase-9, between C and Cal groups. Polarization microscopy images analysis showed that the Cal group presented a slightly higher birefringence compared with the C group. In sections of tendons stained with toluidine blue, the transected groups presented higher metachromasy as compared with the N group. Immunocytochemistry analysis for chondroitin-6-sulfate showed no difference between the C and Cal groups. In conclusion, the topical application of C. officinalis after tendon transection increases the concentrations of collagen and non-collagenous proteins, as well as the collagen organization in the initial phase of healing.
Resumo:
Process Analytical Chemistry (PAC) is an important and growing area in analytical chemistry, that has received little attention in academic centers devoted to the gathering of knowledge and to optimization of chemical processes. PAC is an area devoted to optimization and knowledge acquisition of chemical processes, to reducing costs and wastes and to making an important contribution to sustainable development. The main aim of this review is to present to the Brazilian community the development and state of the art of PAC, discussing concepts, analytical techniques currently employed in the industry and some applications.
Resumo:
The aim of this study was to analyze the prevalence of hypertension and control practices among the elderly. The survey analyzed data from 872 elderly people in São Paulo, Brazil, through a cluster sampling, stratified according to education and income. A Poisson multiple regression model checked for the existence of factors associated with hypertension. The prevalence of self-reported hypertension among the elderly was 46.9%. Variables associated with hypertension were self-rated health, alcohol consumption, gender, and hospitalization in the last year, regardless of age. The three most common measures taken to control hypertension, but only rarely, are oral medication, routine salt-free diet and physical activity. Lifestyle and socioeconomic status did not affect the practice of control, but knowledge about the importance of physical activity was higher among those older people with higher education and greater income. The research suggests that health policies that focus on primary care to encourage lifestyle changes among the elderly are necessary.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
In this paper, space adaptivity is introduced to control the error in the numerical solution of hyperbolic systems of conservation laws. The reference numerical scheme is a new version of the discontinuous Galerkin method, which uses an implicit diffusive term in the direction of the streamlines, for stability purposes. The decision whether to refine or to unrefine the grid in a certain location is taken according to the magnitude of wavelet coefficients, which are indicators of local smoothness of the numerical solution. Numerical solutions of the nonlinear Euler equations illustrate the efficiency of the method. © Springer 2005.
Resumo:
Dental erosion is a type of wear caused by non bacterial acids or chelation. There is evidence of a significant increase in the prevalence of dental wear in the deciduous and permanent teeth as a consequence of the frequent intake of acidic foods and drinks, or due to gastric acid which may reach the oral cavity following reflux or vomiting episodes. The presence of acids is a prerequisite for dental erosion, but the erosive wear is complex and depends on the interaction of biological, chemical and behavioral factors. Even though erosion may be defined or described as an isolated process, in clinical situations other wear phenomena are expected to occur concomitantly, such as abrasive wear (which occurs, e.g, due to tooth brushing or mastication). In order to control dental loss due to erosive wear it is crucial to take into account its multifactorial nature, which predisposes some individuals to the condition.
Resumo:
The mechanical control of supragingival biofilm is accepted as one of the most important measures to treat and prevent dental caries and periodontal diseases. Nevertheless, maintaining dental surfaces biofilm-free is not an easy task. In this regard, chemical agents, mainly in the form of mouthwashes, have been studied to help overcome the difficulties involved in the mechanical control of biofilm. The aim of this paper was to discuss proposals for the teaching of supragingival chemical control (SCC) in order to improve dentists' knowledge regarding this clinical issue. Firstly, the literature regarding the efficacy of antiseptics is presented, clearly showing that chemical agents are clinically effective in the reduction of biofilm and gingival inflammation when used as adjuvant agents to mechanical control. Thus, it is suggested that the content related to SCC be included in the curricular grid of dental schools. Secondly, some essential topics are recommended to be included in the teaching of SCC as follows: skills and competencies expected of a graduate dentist regarding SCC; how to include this content in the curricular grid; teaching-learning tools and techniques to be employed; and program content.
Resumo:
The arterial partial pressure (P CO2) of carbon dioxide is virtually constant because of the close match between the metabolic production of this gas and its excretion via breathing. Blood gas homeostasis does not rely solely on changes in lung ventilation, but also to a considerable extent on circulatory adjustments that regulate the transport of CO2 from its sites of production to the lungs. The neural mechanisms that coordinate circulatory and ventilatory changes to achieve blood gas homeostasis are the subject of this review. Emphasis will be placed on the control of sympathetic outflow by central chemoreceptors. High levels of CO2 exert an excitatory effect on sympathetic outflow that is mediated by specialized chemoreceptors such as the neurons located in the retrotrapezoid region. In addition, high CO2 causes an aversive awareness in conscious animals, activating wake-promoting pathways such as the noradrenergic neurons. These neuronal groups, which may also be directly activated by brain acidification, have projections that contribute to the CO2-induced rise in breathing and sympathetic outflow. However, since the level of activity of the retrotrapezoid nucleus is regulated by converging inputs from wake-promoting systems, behavior-specific inputs from higher centers and by chemical drive, the main focus of the present manuscript is to review the contribution of central chemoreceptors to the control of autonomic and respiratory mechanisms.
Resumo:
OBJECTIVE: Despite the relevance of irritability emotions to the treatment, prognosis and classification of psychiatric disorders, the neurobiological basis of this emotional state has been rarely investigated to date. We assessed the brain circuitry underlying personal script-driven irritability in healthy subjects (n = 11) using functional magnetic resonance imaging. METHOD: Blood oxygen level-dependent signal changes were recorded during auditory presentation of personal scripts of irritability in contrast to scripts of happiness or neutral emotional content. Self-rated emotional measurements and skin conductance recordings were also obtained. Images were acquired using a 1,5T magnetic resonance scanner. Brain activation maps were constructed from individual images, and between-condition differences in the mean power of experimental response were identified by using cluster-wise nonparametric tests. RESULTS: Compared to neutral scripts, increased blood oxygen level-dependent signal during irritability scripts was detected in the left subgenual anterior cingulate cortex, and in the left medial, anterolateral and posterolateral dorsal prefrontal cortex (cluster-wise p-value < 0.05). While the involvement of the subgenual cingulate and dorsal anterolateral prefrontal cortices was unique to the irritability state, increased blood oxygen level-dependent signal in dorsomedial and dorsal posterolateral prefrontal regions were also present during happiness induction. CONCLUSION: Irritability induction is associated with functional changes in a limited set of brain regions previously implicated in the mediation of emotional states. Changes in prefrontal and cingulate areas may be related to effortful cognitive control aspects that gain salience during the emergence of irritability.
Resumo:
OBJECTIVE: Because autonomic dysfunction has been found to lead to cardiometabolic disorders and because studies have reported that simvastatin treatment has neuroprotective effects, the objective of the present study was to investigate the effects of simvastatin treatment on cardiovascular and autonomic changes in fructose-fed female rats. METHODS: Female Wistar rats were divided into three groups: controls (n=8), fructose (n=8), and fructose+ simvastatin (n=8). Fructose overload was induced by supplementing the drinking water with fructose (100 mg/L, 18 wks). Simvastatin treatment (5 mg/kg/day for 2 wks) was performed by gavage. The arterial pressure was recorded using a data acquisition system. Autonomic control was evaluated by pharmacological blockade. RESULTS: Fructose overload induced an increase in the fasting blood glucose and triglyceride levels and insulin resistance. The constant rate of glucose disappearance during the insulin intolerance test was reduced in the fructose group (3.4+ 0.32%/min) relative to that in the control group (4.4+ 0.29%/min). Fructose+simvastatin rats exhibited increased insulin sensitivity (5.4+0.66%/min). The fructose and fructose+simvastatin groups demonstrated an increase in the mean arterial pressure compared with controls rats (fructose: 124+2 mmHg and fructose+simvastatin: 126 + 3 mmHg vs. controls: 112 + 2 mmHg). The sympathetic effect was enhanced in the fructose group (73 + 7 bpm) compared with that in the control (48 + 7 bpm) and fructose+simvastatin groups (31+8 bpm). The vagal effect was increased in fructose+simvastatin animals (84 + 7 bpm) compared with that in control (49 + 9 bpm) and fructose animals (46+5 bpm). CONCLUSION: Simvastatin treatment improved insulin sensitivity and cardiac autonomic control in an experimental model of metabolic syndrome in female rats. These effects were independent of the improvements in the classical plasma lipid profile and of reductions in arterial pressure. These results support the hypothesis that statins reduce the cardiometabolic risk in females with metabolic syndrome.
Resumo:
Leukemia incidence in children has increased worldwide in recent decades, particularly due to the rise in acute lymphoblastic leukemia. Studies have associated exposure to non-ionizing radiation generated by low frequency magnetic fields with childhood leukemia. The current article reviews the case-control studies published on this subject. Of 152 articles tracked in different databases, ten studies from North America, Asia, and Europe met the defined selection criteria, with patients diagnosed from 1960 to 2004. Methodological limitations were observed in these articles, including difficulties with the procedures for assessing exposure. An association may exist between exposure to low frequency magnetic fields and acute lymphoblastic leukemia in children, but this association is weak, preventing the observation of consistency in the findings. Future studies from a wider range of geographic regions should focus on the analysis of acute lymphoblastic leukemia, which is the subtype with the greatest impact on the increasing overall incidence of childhood leukemia.
Resumo:
Cardiovascular diseases (CVD) are the main causes of death in the Western world. Among the risk factors that are modifiable by diet, for reducing cardiovascular disease risks, the total plasma concentrations of cholesterol, triglycerides, LDL-C, and HDL-C are the most important. Dietary measures can balance these components of the lipid profile thus reducing the risk of cardiovascular diseases. The main food components that affect the lipid profile and can be modified by diet are the saturated and trans fats, unsaturated fats, cholesterol, phytosterols, plant protein, and soluble fiber. A wealth of evidence suggests that saturated and trans fats and cholesterol in the diet raise the total plasma cholesterol and LDL-C. Trans fats also reduce HDL-C, an important lipoprotein for mediating the reverse cholesterol transport. On the other hand, phytosterols, plant proteins, isoflavones, and soluble fiber are protective diet factors against cardiovascular diseases by modulating plasma lipoprotein levels. These food components at certain concentrations are able to reduce the total cholesterol, TG, and LDL-C and raise the plasma levels of HDL-C. Therefore, diet is an important tool for the prevention and control of cardiovascular diseases, and should be taken into account as a whole, i.e., not only the food components that modulate plasma concentrations of lipoproteins, but also the diet content of macro nutrients and micronutrients should be considered.
Resumo:
A case-control study was carried out in litters of 1 to 7-day-old piglets to identify the main infectious agents involved with neonatal diarrhea in pigs. Fecal samples (n=276) from piglets were collected on pig farms in the State of Rio Grande do Sul, Brazil, from May to September 2007. Litters with diarrhea were considered cases (n=129) and normal litters (n=147) controls. The samples were examined by latex agglutination test, PAGE, conventional isolating techniques, ELISA, PCR, and microscopic methods in order to detect rotavirus, bacterial pathogens (Escherichia coli, Clostridium perfringens type A and C, and Clostridium difficile), and parasites (Coccidian and Cryptosporidium spp.). Outbreaks of diarrhea were not observed during sampling. At least one agent was detected in fecal samples on 25 out of 28 farms (89.3%) and in 16 farms (57.1%) more than one agent was found. The main agents diagnosed were Coccidia (42.86%) and rotavirus (39.29%). The main agents identified in litters with diarrhea were Clostridium difficile (10.6%), Clostridium perfringens type A (8.8%) and rotavirus (7.5%); in control litters, Clostridium difficile (16.6%) and Coccidian (8.5%). Beta hemolytic Escherichia coli and Clostridium perfringens type C were not detected. When compared with controls, no agent was significantly associated with diarrhea in case litters. These findings stress the need for caution in the interpretation of laboratorial diagnosis of mild diarrhea in neonatal pigs, as the sole detection of an agent does not necessarily indicate that it is the cause of the problem.
Resumo:
Identification of animals that are decomposing or have been run over or burnt and cannot be visually identified is a problem in the surveillance and control of infectious diseases. Many of these animals are wild and represent a valuable source of information for epidemiologic research as they may be carriers of an infectious agent. This article discusses the results obtained using a method for identifying mammals genetically by sequencing their mitochondrial DNA control region. Fourteen species were analyzed and identified. These included the main reservoirs and transmitters of rabies virus, namely, canids, chiroptera and primates. The results prove that this method of genetic identification is both efficient and simple and that it can be used in the surveillance of infectious diseases which includes mammals in their epidemiologic cycle, such as rabies.